WormBase Tree Display for Variation: WBVar00089691
expand all nodes | collapse all nodes | view schema
WBVar00089691 | Evidence | Paper_evidence | WBPaper00001768 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n709 | |||||||
Other_name | C07H6.7.2:c.-1G>A | ||||||||
C07H6.7.1:c.1-1G>A | |||||||||
HGVSg | CHROMOSOME_III:g.7534701C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C07H6 | |||||
Flanking_sequences | tatcaatcactttcactcgttttcactcca | atgaccacatcaacatcaccgtcatccaca | |||||||
Mapping_target | C07H6 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001768 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026857 | ||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003024 | |||||||
Transcript | C07H6.7.2 | VEP_consequence | 5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | C07H6.7.2:c.-1G>A | ||||||||
cDNA_position | 105 | ||||||||
Exon_number | 1/7 | ||||||||
C07H6.7.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C07H6.7.1:c.1-1G>A | ||||||||
Intron_number | 1/6 | ||||||||
Interactor | WBInteraction000002755 | ||||||||
WBInteraction000002764 | |||||||||
WBInteraction000500077 | |||||||||
WBInteraction000500078 | |||||||||
WBInteraction000521976 | |||||||||
WBInteraction000535543 | |||||||||
WBInteraction000535544 | |||||||||
Genetics | Interpolated_map_position | III | -0.673654 | ||||||
Description | Phenotype | WBPhenotype:0000099 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some or all P3.aap - P8.aap (presumptive VC neurons) die in hermaphrodites, very hard to score (ES1). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005304 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000216 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Multiple defects in specification of fates in mid-body. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00005344 | |||||||
WBPaper00005277 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-39(n709) mutation resulted in fewer than the expected number of induced vulval precursor cells (2.58 on average instead of 3.0 in wild type) | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table 3 | Paper_evidence | WBPaper00005277 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00005344 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000239 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Variably abnormal vulval divisions. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000542 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Variably Egl, difficult to score (ES2). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00005344 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-39(n709) mutation resulted in a vulvaless phenotype in 56% of animals | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00005344 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00005609 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 76% (n=160) of unfused P5.p-P7.p cells in lin-39(+) worms expressed elt-18/elt-6::GFP, only 42% (n=85) did so in animals carrying n709. | Paper_evidence | WBPaper00005609 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005609 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001818 | Paper_evidence | WBPaper00032221 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | HSN neurons showed increased activity, as demonstrated by increased calcium spike frequency compared to wild-type animals, even in conditions of high-osmolarity. | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00032221 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested in low or high osmolarity. Animals were assayed 24 hr after the late fourth larval (L4) stage at 20.5C 0.5C. | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Cameleon IjIs25[myo-3::YC2.0] | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002287 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002290 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002292 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002299 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002302 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002314 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002319 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002344 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-39(n709) mutation did not induce the "2 P11.p" phenotype where the P12 cell adopts a P11 cell fate | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001816 | Paper_evidence | WBPaper00032221 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Egg-laying events were still strongly correlated with HSN activity. | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Combined fluorescent and visible microscopy was used to view both the Ca2+ signal and egg-laying events simultaneously. Animals were assayed 24 hr after the late fourth larval (L4) stage at 20.5C 0.5C. | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Cameleon IjIs25[myo-3::YC2.0] | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00005277 | |||||||||
WBPaper00005344 | |||||||||
WBPaper00016118 | |||||||||
WBPaper00014076 | |||||||||
WBPaper00032221 | |||||||||
WBPaper00016177 | |||||||||
WBPaper00015250 | |||||||||
WBPaper00005609 | |||||||||
Method | Substitution_allele |