WormBase Tree Display for Variation: WBVar00089674
expand all nodes | collapse all nodes | view schema
| WBVar00089674 | Evidence | Paper_evidence | WBPaper00002466 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n686 | |||||
| Other_name | M01D7.7b.1:c.438-1G>A | ||||||
| M01D7.7a.1:c.594-1G>A | |||||||
| HGVSg | CHROMOSOME_I:g.1839250G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | M01D7 | |||
| Flanking_sequences | cattcaaaaaacggaaaattgtgttttcca | aatggtggacgtcggaggtcagcgatcaga | |||||
| Mapping_target | M01D7 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002466 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00022472 | ||||||
| WBStrain00026844 | |||||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001196 | |||||
| Transcript | M01D7.7b.1 | VEP_consequence | splice_acceptor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | M01D7.7b.1:c.438-1G>A | ||||||
| Intron_number | 4/8 | ||||||
| M01D7.7a.1 | VEP_consequence | splice_acceptor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | M01D7.7a.1:c.594-1G>A | ||||||
| Intron_number | 5/9 | ||||||
| Interactor | WBInteraction000503446 | ||||||
| WBInteraction000517563 | |||||||
| WBInteraction000517571 | |||||||
| WBInteraction000518669 | |||||||
| WBInteraction000520751 | |||||||
| WBInteraction000524573 | |||||||
| WBInteraction000542452 | |||||||
| Genetics | Interpolated_map_position | I | -12.5532 | ||||
| Mapping_data | In_2_point | 736 | |||||
| In_multi_point | 634 | ||||||
| In_pos_neg_data | 3968 | ||||||
| 3976 | |||||||
| 3986 | |||||||
| 3994 | |||||||
| 4003 | |||||||
| 4087 | |||||||
| 6277 | |||||||
| Description | Phenotype (21) | ||||||
| Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Mutations in egl-30 did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00040857 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference (15) | |||||||
| Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
| Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
| Method | Substitution_allele |
