WormBase Tree Display for Variation: WBVar00089663
expand all nodes | collapse all nodes | view schema
WBVar00089663 | Evidence | Paper_evidence | WBPaper00001306 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n676 | |||||||
Other_name | R107.8.1:c.2651G>A | ||||||||
CE00274:p.Gly884Asp | |||||||||
HGVSg | CHROMOSOME_III:g.9062738C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | R107 | |||||
Flanking_sequences | ggcttgcaaagaagggaatcgattcttttg | tattccaatctcagaagctcttgtcgcaga | |||||||
Mapping_target | R107 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001306 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007981 | ||||||||
WBStrain00007982 | |||||||||
WBStrain00008018 | |||||||||
WBStrain00008019 | |||||||||
WBStrain00008020 | |||||||||
WBStrain00008021 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar02141279 | ||||||||
WBVar00089665 | |||||||||
WBVar00089664 | |||||||||
Affects | Gene | WBGene00003001 | |||||||
Transcript | R107.8.1 (12) | ||||||||
Interactor (2) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 0.132774 | ||||||
Mapping_data | In_multi_point | 890 | |||||||
891 | |||||||||
892 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001306 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Egg-laying defect is a direct consequence of the trasnformation of the presumptive AC into a VU. | Paper_evidence | WBPaper00001306 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | For heterozygote; penetrance for heterozygote is higher at 20 deg. | Paper_evidence | WBPaper00001306 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Range | 70 | 70 | Paper_evidence | WBPaper00001306 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001306 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00001306 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | Visual inspection at 25 degrees. | Paper_evidence | WBPaper00001306 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00001306 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Genotype | n676/+ | Paper_evidence | WBPaper00001306 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000170 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult lateral alae were present in 30% L4 (n=40) and 100% adult (n=33) animals. | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007832 | PATO:0000460 | Paper_evidence | WBPaper00031590 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00001306 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Both Z1.ppp and Z1.aaa adopt a VU fate; in WT one of these cells becomes an anchor cell (adopts the AC fate) and signal from the AC signals the other cell to adopt a VU fate. | Paper_evidence | WBPaper00001306 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00001306 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00001306 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | Ablation of all other somatic gonadal cells to isolate Z1.ppp or Z4.aaa. | Paper_evidence | WBPaper00001306 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00028987 | |||||||
WBPaper00000762 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | semidominant Vul phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | 75 percent penetrance under heterozygous conditions, 100 percent penetrance under homozygous conditions | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00000762 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00028987 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00028987 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Phenotype_assay | Genotype | dpy-17(e164) | Paper_evidence | WBPaper00028987 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00001306 | |||||||
WBPaper00028987 | |||||||||
WBPaper00032182 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
WBPerson712 | |||||||||
Remark | Characteristic of transformation of the vulval precursor cell fates. | Paper_evidence | WBPaper00001306 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
A low percentage of animals exhibited psuedovulvae. | Paper_evidence | WBPaper00032182 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Rare in homozygotes, heterozygotes, and hemizygotes. | Paper_evidence | WBPaper00001306 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Paper_evidence | WBPaper00028987 | ||||||||
WBPaper00032182 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Range | 21 | 21 | Paper_evidence | WBPaper00028987 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001306 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00032182 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00028987 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00028987 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | dpy-17(e164) | Paper_evidence | WBPaper00028987 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (14) | |||||||||
Method | Substitution_allele |