WormBase Tree Display for Variation: WBVar00089611
expand all nodes | collapse all nodes | view schema
WBVar00089611 | Evidence | Paper_evidence | WBPaper00003383 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | W08D2 | |||
Flanking_sequences | acttacctctcaaatttgaacttattctcgc | ttctcgaattgcttcacgaactccgcgagc | |||||
Mapping_target | W08D2 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (11) | |||||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001188 | |||||
Transcript | W08D2.1.3 (12) | ||||||
W08D2.1.1 (12) | |||||||
W08D2.1.2 (12) | |||||||
Interactor (43) | |||||||
Genetics | Interpolated_map_position | IV | 4.42311 | ||||
Mapping_data | In_2_point | 729 | |||||
In_multi_point | 625 | ||||||
1909 | |||||||
1910 | |||||||
1911 | |||||||
1912 | |||||||
2046 | |||||||
2090 | |||||||
In_pos_neg_data | 5746 | ||||||
6020 | |||||||
6021 | |||||||
6022 | |||||||
Description | Phenotype (24) | ||||||
Phenotype_not_observed (14) | |||||||
Reference (32) | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |