WormBase Tree Display for Variation: WBVar00089610
expand all nodes | collapse all nodes | view schema
WBVar00089610 | Evidence | Paper_evidence | WBPaper00002912 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n582 | |||||||
Other_name | CE28820:p.Arg899His | ||||||||
C48A7.1b.1:c.2696G>A | |||||||||
CE31165:p.Arg899His | |||||||||
C48A7.1a.1:c.2696G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.7411562G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C48A7 | |||||
Flanking_sequences | tgtctgtcgtcaagattcttcgtgtgctcc | tgtgctccgtccacttcgtgcaattaaccg | |||||||
Mapping_target | C48A7 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002912 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (12) | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar02125351 | ||||||||
Affects | Gene | WBGene00001187 | |||||||
Transcript | C48A7.1a.1 (12) | ||||||||
C48A7.1b.1 (12) | |||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals retained significantly more eggs in utero than wild-type worms. | Paper_evidence | WBPaper00031871 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
Affected_by | Molecule | WBMol:00001631 | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | DMSO control conditions. | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000007 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000011 | Paper_evidence | WBPaper00031871 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were resistant to population growth retardation induced by nemadipine-A, a dihydropyridine (DHP) analog. In addition, L1 and L2 exhibited variable morphology at concentrations significantly greater than the concentration that induced Vab in wild-type larvae. | Paper_evidence | WBPaper00031871 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
Phenotype_assay | Treatment | Animals were treated with various concentrations of nemadipine in DMSO. | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000022 | Paper_evidence | WBPaper00000635 | |||||||
WBPaper00031871 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
WBPhenotype:0000349 | Paper_evidence | WBPaper00000635 | |||||||
WBPaper00031871 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | floppy | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
WBPhenotype:0000646 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000862 | Paper_evidence | WBPaper00004071 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | moderate bloating; n582/Df more severe phenotypes; easy to score (ES3) in adult, difficult to score (ES2) at other stages | Paper_evidence | WBPaper00004071 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Paper_evidence | WBPaper00004071 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00031871 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals retained less eggs after treatment with dihydropyridine (DHP) analog nemadipine compared to animals treated with DMSO alone; wild-type worms retained more eggs after treatment with the DHP anaolog. | Paper_evidence | WBPaper00031871 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function (2) | ||||||||
Affected_by | Molecule | WBMol:00001631 | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0018991 | PATO:0000460 | Paper_evidence | WBPaper00031871 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 5uM nemadipine in DMSO or DMSO alone | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001340 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Animals respond only weakly to imipramine. | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Disease_info | Models_disease | DOID:11723 | |||||||
Models_disease_in_annotation | WBDOannot00000289 | ||||||||
Reference (17) | |||||||||
Method | Substitution_allele |