WormBase Tree Display for Variation: WBVar00089602
expand all nodes | collapse all nodes | view schema
WBVar00089602 | Evidence | Paper_evidence | WBPaper00003860 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n571 | ||||||
Other_name | F22E12.4b.1:c.1083+172G>A | |||||||
F22E12.4b.3:c.1083+172G>A | ||||||||
F22E12.4e.1:c.950+1G>A | ||||||||
F22E12.4a.1:c.1178+1G>A | ||||||||
F22E12.4c.1:c.404+1G>A | ||||||||
F22E12.4d.1:c.1178+1G>A | ||||||||
F22E12.4b.2:c.1083+172G>A | ||||||||
HGVSg | CHROMOSOME_V:g.10474188G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y32F6B | ||||
Flanking_sequences | gggctcggatcactacaaatttaccgcgaa | tgagtgactagatgtaaaggttttttgtcg | ||||||
Mapping_target | Y32F6B | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003860 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026809 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001178 | ||||||
Transcript | F22E12.4b.3 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | F22E12.4b.3:c.1083+172G>A | |||||||
Intron_number | 6/10 | |||||||
F22E12.4b.2 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | F22E12.4b.2:c.1083+172G>A | |||||||
Intron_number | 7/8 | |||||||
F22E12.4a.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4a.1:c.1178+1G>A | |||||||
Intron_number | 8/11 | |||||||
F22E12.4b.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | F22E12.4b.1:c.1083+172G>A | |||||||
Intron_number | 7/10 | |||||||
F22E12.4c.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4c.1:c.404+1G>A | |||||||
Intron_number | 5/8 | |||||||
F22E12.4e.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4e.1:c.950+1G>A | |||||||
Intron_number | 5/7 | |||||||
F22E12.4d.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F22E12.4d.1:c.1178+1G>A | |||||||
Intron_number | 8/10 | |||||||
Interactor (84) | ||||||||
Genetics | Interpolated_map_position | V | 2.56742 | |||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00000635 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000339 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | transient bloating, non-ts | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00003860 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are resistant to paralysis by infection with P. aeruginosa PAO1. | Paper_evidence | WBPaper00003860 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031935 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed attraction to carbon dioxide as opposed to the wild-type response of avoidance. | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Strains were maintained at 22C. Animals were exposed to a 5% to 0% CO2 gradient. | Paper_evidence | WBPaper00031935 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031935 | |||||||
WBPaper00000635 | ||||||||
WBPaper00003860 | ||||||||
WBPaper00025692 | ||||||||
Method | Substitution_allele |