WormBase Tree Display for Variation: WBVar00089553
expand all nodes | collapse all nodes | view schema
| WBVar00089553 | Evidence | Paper_evidence | WBPaper00003764 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n498 | |||||||
| Other_name (27) | |||||||||
| HGVSg | CHROMOSOME_IV:g.10338870C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | K11E8 | |||||
| Flanking_sequences | gaggacattgttgctcgcgagttttattca | aagcggatgcaaggtgagtatttcggatag | |||||||
| Mapping_target | K11E8 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003764 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00026793 | ||||||||
| WBStrain00026984 | |||||||||
| WBStrain00026985 | |||||||||
| WBStrain00030736 | |||||||||
| WBStrain00030763 | |||||||||
| WBStrain00040667 | |||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Linked_to | WBVar00089554 | ||||||||
| WBVar00089555 | |||||||||
| Affects | Gene | WBGene00006779 | |||||||
| Transcript (17) | |||||||||
| Interactor | WBInteraction000520385 | ||||||||
| WBInteraction000525210 | |||||||||
| Genetics | Interpolated_map_position | IV | 4.57623 | ||||||
| Mapping_data | In_multi_point | 1136 | |||||||
| 1137 | |||||||||
| 1138 | |||||||||
| 1139 | |||||||||
| 1297 | |||||||||
| Description | Phenotype (19) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00027345 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | unc-43(n498) mutant males do not exhibit a B cell polarity defect | Paper_evidence | WBPaper00027345 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0001715 | PATO:0000460 | Paper_evidence | WBPaper00027345 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBbt:0001750 | PATO:0000460 | Paper_evidence | WBPaper00027345 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000553 | Paper_evidence | WBPaper00000914 | |||||||
| Curator_confirmed | WBPerson48 | ||||||||
| Remark | body wall musculature appears to be normal | Paper_evidence | WBPaper00000914 | ||||||
| Curator_confirmed | WBPerson48 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00000914 | |||||||
| Curator_confirmed | WBPerson48 | ||||||||
| Phenotype_assay | Genotype | n498/n498 | Paper_evidence | WBPaper00000914 | |||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| WBPaper00003760 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| gcy-5 was asymmetrically expressed only in ASER in unc-43 mutants | Paper_evidence | WBPaper00003760 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00006052 | ||||||
| WBPaper00003760 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001677 | Paper_evidence | WBPaper00056945 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals did not stain with mAbM3. | Paper_evidence | WBPaper00056945 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Image | WBPicture0000014905 | Paper_evidence | WBPaper00056945 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (18) | |||||||||
| Method | Substitution_allele |
