WormBase Tree Display for Variation: WBVar00089540
expand all nodes | collapse all nodes | view schema
WBVar00089540 | Evidence | Paper_evidence | WBPaper00002646 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n491 | |||||
Other_name | CE48967:p.Gly386Glu | ||||||
CE26381:p.Gly387Glu | |||||||
R13A1.4a.1:c.1160G>A | |||||||
R13A1.4c.1:c.1163G>A | |||||||
R13A1.4b.1:c.1157G>A | |||||||
CE49123:p.Gly388Glu | |||||||
R13A1.4d.1:c.1040G>A | |||||||
CE04840:p.Gly347Glu | |||||||
HGVSg | CHROMOSOME_IV:g.7201523G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | R13A1 | |||
Flanking_sequences | aggataattttcaggacctcaaagatgcgg | agccatcacaactcaaacaaaagaaaattt | |||||
Mapping_target | R13A1 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002646 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (13) | |||||||
Laboratory | MT | ||||||
Status | Live | ||||||
Linked_to | WBVar00089541 | ||||||
WBVar00089542 | |||||||
WBVar01474480 | |||||||
Affects | Gene | WBGene00006748 | |||||
Transcript | R13A1.4d.1 (12) | ||||||
R13A1.4c.1 (12) | |||||||
R13A1.4a.1 (12) | |||||||
R13A1.4b.1 (12) | |||||||
Interactor | WBInteraction000517793 | ||||||
WBInteraction000517984 | |||||||
WBInteraction000518385 | |||||||
Genetics | Interpolated_map_position | IV | 3.29358 | ||||
Mapping_data | In_2_point | 825 | |||||
826 | |||||||
827 | |||||||
1661 | |||||||
In_multi_point | 159 | ||||||
750 | |||||||
779 | |||||||
780 | |||||||
1512 | |||||||
2464 | |||||||
2465 | |||||||
Description | Phenotype | WBPhenotype:0000565 | Paper_evidence | WBPaper00000914 | |||
Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | ||||||
WBPerson712 | |||||||
Remark | Homozygotes coil immediately in response to a tap on the head; heterozygotes back slightly, then assume a multiply curved posture, and then coil. Coiler posture is assumed because animals simultaneously fold both the anterior and posterior parts of their bodies. | Paper_evidence | WBPaper00000914 | ||||
Curator_confirmed | WBPerson48 | ||||||
homozygotes strong coilers, n491/+ coiler, slightly weaker phenotype than other alleles | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00000914 | |||||
Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson48 | ||||||
WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0002535 | Paper_evidence | WBPaper00003408 | ||||
Curator_confirmed | WBPerson557 | ||||||
Remark | ASH degeneration was assessed by dye filling with DiO. | Paper_evidence | WBPaper00003408 | ||||
Curator_confirmed | WBPerson557 | ||||||
Reference (11) | |||||||
Method | Substitution_allele |