WormBase Tree Display for Variation: WBVar00089540
expand all nodes | collapse all nodes | view schema
| WBVar00089540 | Evidence | Paper_evidence | WBPaper00002646 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n491 | |||||
| Other_name | CE48967:p.Gly386Glu | ||||||
| CE26381:p.Gly387Glu | |||||||
| R13A1.4a.1:c.1160G>A | |||||||
| R13A1.4c.1:c.1163G>A | |||||||
| R13A1.4b.1:c.1157G>A | |||||||
| CE49123:p.Gly388Glu | |||||||
| R13A1.4d.1:c.1040G>A | |||||||
| CE04840:p.Gly347Glu | |||||||
| HGVSg | CHROMOSOME_IV:g.7201523G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | R13A1 | |||
| Flanking_sequences | aggataattttcaggacctcaaagatgcgg | agccatcacaactcaaacaaaagaaaattt | |||||
| Mapping_target | R13A1 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002646 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (13) | |||||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Linked_to | WBVar00089541 | ||||||
| WBVar00089542 | |||||||
| WBVar01474480 | |||||||
| Affects | Gene | WBGene00006748 | |||||
| Transcript | R13A1.4d.1 (12) | ||||||
| R13A1.4c.1 (12) | |||||||
| R13A1.4a.1 (12) | |||||||
| R13A1.4b.1 (12) | |||||||
| Interactor | WBInteraction000517793 | ||||||
| WBInteraction000517984 | |||||||
| WBInteraction000518385 | |||||||
| Genetics | Interpolated_map_position | IV | 3.29358 | ||||
| Mapping_data | In_2_point | 825 | |||||
| 826 | |||||||
| 827 | |||||||
| 1661 | |||||||
| In_multi_point | 159 | ||||||
| 750 | |||||||
| 779 | |||||||
| 780 | |||||||
| 1512 | |||||||
| 2464 | |||||||
| 2465 | |||||||
| Description | Phenotype | WBPhenotype:0000565 | Paper_evidence | WBPaper00000914 | |||
| Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPerson712 | |||||||
| Remark | Homozygotes coil immediately in response to a tap on the head; heterozygotes back slightly, then assume a multiply curved posture, and then coil. Coiler posture is assumed because animals simultaneously fold both the anterior and posterior parts of their bodies. | Paper_evidence | WBPaper00000914 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| homozygotes strong coilers, n491/+ coiler, slightly weaker phenotype than other alleles | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00000914 | |||||
| Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPerson712 | |||||||
| Phenotype_not_observed | WBPhenotype:0002535 | Paper_evidence | WBPaper00003408 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | ASH degeneration was assessed by dye filling with DiO. | Paper_evidence | WBPaper00003408 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| Reference (11) | |||||||
| Method | Substitution_allele |
