WormBase Tree Display for Variation: WBVar00089534
expand all nodes | collapse all nodes | view schema
WBVar00089534 | Name | Public_name | n487 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | n1084 | Paper_evidence | WBPaper00003631 | ||||||
n1796 | Paper_evidence | WBPaper00003631 | |||||||
Sequence_details | SMap | S_parent | Sequence | VF23B12L | |||||
Flanking_sequences | TATTGGGTATTGTTTACTCCTAACCGGGTG | TCCATAAAATTCTATTGTCCCAGATTTAGG | |||||||
Mapping_target | VF23B12L | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003631 | ||||
Person_evidence | WBPerson117 | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026625 | ||||||||
WBStrain00026787 | |||||||||
WBStrain00026979 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001170 | |||||||
Interactor | WBInteraction000518991 | ||||||||
Genetics | Interpolated_map_position | V | 6.30574 | ||||||
Mapping_data | In_2_point | 721 | |||||||
In_multi_point | 605 | ||||||||
606 | |||||||||
615 | |||||||||
748 | |||||||||
942 | |||||||||
1179 | |||||||||
1180 | |||||||||
Description | Phenotype (31) | ||||||||
Phenotype_not_observed | WBPhenotype:0000386 | Paper_evidence | WBPaper00035318 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Cobalt-induced germline cell apoptosis was unaffected in egl-1(n487) mutants (Figure 2) | Paper_evidence | WBPaper00035318 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003058 | Paper_evidence | WBPaper00035318 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Synchronized young adult hermaphrodites were treated in K-medium with 0.01 millimolar Cobalt chloride for 12 hours, and apoptotic cells were scored after AO staining. | Paper_evidence | WBPaper00035318 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001024 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No phenotype in male. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001068 | Paper_evidence (2) | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
7.5 mg/ml serotonin | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001336 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | As described in Hodgkin, Horvitz, and Brenner (1979), six L4 males and six L4 dpy-11 hermaphrodites incubated for 24 hours, males removed, and hermaphrodites transferred to fresh dishes each day. Cross-progeny are counted. | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001629 | Paper_evidence | WBPaper00031977 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were insensitive to the egg-laying inducing effects of 5HT (serotonin) (n=50). | Paper_evidence | WBPaper00031977 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Stimulated by serotonin. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00031977 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031977 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (17) | |||||||||
Method | Substitution_allele |