WormBase Tree Display for Variation: WBVar00089533
expand all nodes | collapse all nodes | view schema
| WBVar00089533 | Evidence | Paper_evidence | WBPaper00032921 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n486 | |||||||
| Other_name | CE34523:p.Arg162Cys | ||||||||
| C08C3.1b.1:c.487C>T | |||||||||
| CE29076:p.Arg159Cys | |||||||||
| C08C3.1a.1:c.475C>T | |||||||||
| C08C3.1c.1:c.484C>T | |||||||||
| CE32792:p.Arg163Cys | |||||||||
| HGVSg | CHROMOSOME_III:g.7816155C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C08C3 | |||||
| Flanking_sequences | agatcgtcaaatcaaaatctggttccaaaat | gtcgaatgaaggcgaaaaaagagaagcaaag | |||||||
| Mapping_target | C08C3 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00032921 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00026786 | ||||||||
| WBStrain00030544 | |||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001174 | |||||||
| Transcript | C08C3.1b.1 (12) | ||||||||
| C08C3.1c.1 (12) | |||||||||
| C08C3.1a.1 (12) | |||||||||
| Interactor | WBInteraction000002751 | ||||||||
| WBInteraction000004090 | |||||||||
| WBInteraction000501947 | |||||||||
| WBInteraction000503518 | |||||||||
| WBInteraction000503914 | |||||||||
| WBInteraction000519180 | |||||||||
| WBInteraction000524371 | |||||||||
| Genetics | Interpolated_map_position | III | -0.582044 | ||||||
| Mapping_data | In_2_point | 716 | |||||||
| In_multi_point | 611 | ||||||||
| 868 | |||||||||
| In_pos_neg_data | 1621 | ||||||||
| Description | Phenotype (38) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | egl-5(n486)/+ heterozygotes did not display a "2 P11.p" phenotype where P12 adopts a P11 fate | Paper_evidence | WBPaper00005344 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We therefore determined the orientation of P(11/12)L/R migration in mutants affecting P12 determination: a lin-44; lin-3 double mutant, a lin-17 mutant (LIN-17 is the putative receptor of Wnt/LIN-44; Herman et_al, 1995; Sawa et_al, 1996), a bar-1 mutant (BAR-1/Armadillo is an effector of the Wnt pathway; Eisenmann et_al, 1998), and an egl-5 mutant. In all mutants observed, both cells of the P11/12 pair generally adopt the P11 fate (Table 1A). If the migration handedness was a consequence of fate determination, it should be unbiased in these mutants. However, we see a biased migration pattern of P(11/12)L/R similar to that of wild type (Table 1A). Thus, a left-right asymmetry between the two cells of the P11/12 pair still exists in mutants of their final fate determination." | Paper_evidence | WBPaper00004662 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | |||||||
| WBPaper00001133 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPerson2021 | |||||||||
| WBPerson712 | |||||||||
| Remark | Stimulated by serotonin. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Recessive | Paper_evidence | WBPaper00001133 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | |||||
| Curator_confirmed | WBPerson48 | ||||||||
| 7.5 mg/ml serotonin | Paper_evidence | WBPaper00001133 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00040284 | ||||||||
| WBPaper00043908 | |||||||||
| WBPaper00005344 | |||||||||
| WBPaper00000635 | |||||||||
| WBPaper00014695 | |||||||||
| WBPaper00001105 | |||||||||
| WBPaper00001133 | |||||||||
| WBPaper00013865 | |||||||||
| WBPaper00004662 | |||||||||
| Method | Substitution_allele |
