WormBase Tree Display for Variation: WBVar00089402
expand all nodes | collapse all nodes | view schema
WBVar00089402 | Evidence | Paper_evidence | WBPaper00001306 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n302 | |||||||
Other_name | CE00274:p.Gly747Asp | ||||||||
R107.8.1:c.2240G>A | |||||||||
HGVSg | CHROMOSOME_III:g.9063149C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | R107 | |||||
Flanking_sequences | gtaatacaaatggatgtggttttgatggtg | tgattgtgataatgaaacgaatgccacaat | |||||||
Mapping_target | R107 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001306 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Linked_to | WBVar00089403 | ||||||||
Affects | Gene | WBGene00003001 | |||||||
Transcript | R107.8.1 (12) | ||||||||
Interactor (28) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 0.133229 | ||||||
Mapping_data | In_multi_point | 887 | |||||||
1086 | |||||||||
2305 | |||||||||
2306 | |||||||||
2307 | |||||||||
2308 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00000646 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | (Table 1) | Paper_evidence | WBPaper00000646 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000170 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult lateral alae were present in 29% L4 (n=31) and 100% adult (n=10) animals. | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007832 | PATO:0000460 | Paper_evidence | WBPaper00031590 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00028987 | |||||||
WBPaper00000762 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | semidominant Vul phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 66 percent penetrance under heterozygous conditions, 99 percent penetrance under homozygous conditions | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00000762 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00028987 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028987 | |||||
WBPaper00000762 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00028987 | |||||||
WBPaper00001576 | |||||||||
WBPaper00024442 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Muv has weak expressivity; however becomes more dramatic when mutant is combined with lin-12(n302). | Paper_evidence | WBPaper00001576 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
weak | Paper_evidence | WBPaper00024442 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00028987 | ||||||
WBPaper00001576 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Range | 2 | 2 | Paper_evidence | WBPaper00028987 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001576 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00024442 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028987 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00001576 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000127 | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not recover significantly faster than wild type under the same conditions. | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00031997 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dauers were induced by pheromone. | Paper_evidence | WBPaper00031997 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00031997 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6, gcy-7 and gcy-5 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3, ntIs1 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (25) | |||||||||
Method | Substitution_allele |