WormBase Tree Display for Variation: WBVar00089286
expand all nodes | collapse all nodes | view schema
WBVar00089286 | Evidence | Paper_evidence | WBPaper00004977 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n150 | |||||||
Other_name | n150ts | ||||||||
CE45708:p.Gly469Glu | |||||||||
CE08940:p.Gly594Glu | |||||||||
C51E3.7c.1:c.1406G>A | |||||||||
C51E3.7a.1:c.1781G>A | |||||||||
HGVSg | CHROMOSOME_V:g.10170178C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C51E3 | |||||
Flanking_sequences | caacacacacatggggagagaatccaacag | aaaatggagacttgtcgccagattccaagt | |||||||
Mapping_target | C51E3 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026704 | ||||||||
WBStrain00056259 | |||||||||
Laboratory | MT | ||||||||
ZAS | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001172 | |||||||
Transcript | C51E3.7a.1 (12) | ||||||||
C51E3.7c.1 (12) | |||||||||
Genetics | Interpolated_map_position | V | 2.28547 | ||||||
Mapping_data | In_2_point | 715 | |||||||
In_multi_point | 329 | ||||||||
608 | |||||||||
609 | |||||||||
797 | |||||||||
953 | |||||||||
In_pos_neg_data | 1732 | ||||||||
1733 | |||||||||
1734 | |||||||||
1741 | |||||||||
Description | Phenotype | WBPhenotype:0000007 | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000122 | Paper_evidence | WBPaper00028958 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Depletion of neuropeptides, presumably because EGL-3 is necessary for neuropeptide processing. | Paper_evidence | WBPaper00028958 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000545 | Paper_evidence | WBPaper00000635 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00000635 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | coiler phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Easy to score (ES3) in adults at 25C. Difficult to score (ES2) in larvae and males. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000862 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | moderate bloating | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001049 | Paper_evidence | WBPaper00048845 | |||||||
Curator_confirmed | WBPerson3990 | ||||||||
Remark | increased sensitivity in acidic pH avoidance | Paper_evidence | WBPaper00048845 | ||||||
Curator_confirmed | WBPerson3990 | ||||||||
Phenotype_not_observed | WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00000635 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | stimulated by imipramine | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00000635 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001629 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | stimulated by serotonin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in neuromodulation respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031936 | ||||||||
WBPaper00000635 | |||||||||
WBPaper00029060 | |||||||||
WBPaper00028958 | |||||||||
WBPaper00048845 | |||||||||
WBPaper00065754 | |||||||||
Method | Substitution_allele |