WormBase Tree Display for Variation: WBVar00089208
expand all nodes | collapse all nodes | view schema
WBVar00089208 | Evidence | Person_evidence | WBPerson554 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mu74 | ||||||
Other_name (15) | ||||||||
HGVSg | CHROMOSOME_X:g.2718795_2718869del | |||||||
Sequence_details | SMap | S_parent | Sequence | T02C5 | ||||
Flanking_sequences | ttgttttatgaagaaattttgaggcttttc | tttcagatttcagaaagctgtacagcagta | ||||||
Mapping_target | T02C5 | |||||||
Type_of_mutation | Deletion | aataccgcattaacggccgtgtttacagtggagagtatattgaagattttggcattcggtgttagagtaagttaa | Person_evidence | WBPerson554 | ||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CF | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006742 | ||||||
Transcript (15) | ||||||||
Genetics | Interpolated_map_position | X | -13.8049 | |||||
Description | Phenotype (7) | |||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00006052 | |||||||
Remark | mu74 deletes the exon/intron boundary so it is likely that 3' protein synthesis would cease at the next stop codon within the intron. | Person_evidence | WBPerson554 | |||||
Method | Deletion_allele |