WormBase Tree Display for Variation: WBVar00089208
expand all nodes | collapse all nodes | view schema
WBVar00089208 | Evidence | Person_evidence | WBPerson554 | |||
---|---|---|---|---|---|---|
Name | Public_name | mu74 | ||||
Other_name (15) | ||||||
HGVSg | CHROMOSOME_X:g.2718795_2718869del | |||||
Sequence_details | SMap | S_parent | Sequence | T02C5 | ||
Flanking_sequences | ttgttttatgaagaaattttgaggcttttc | tttcagatttcagaaagctgtacagcagta | ||||
Mapping_target | T02C5 | |||||
Type_of_mutation | Deletion | aataccgcattaacggccgtgtttacagtggagagtatattgaagattttggcattcggtgttagagtaagttaa | Person_evidence | WBPerson554 | ||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Laboratory | CF | |||||
Status | Live | |||||
Affects | Gene | WBGene00006742 | ||||
Transcript (15) | ||||||
Genetics | Interpolated_map_position | X | -13.8049 | |||
Description (2) | ||||||
Reference | WBPaper00006052 | |||||
Remark | mu74 deletes the exon/intron boundary so it is likely that 3' protein synthesis would cease at the next stop codon within the intron. | Person_evidence | WBPerson554 | |||
Method | Deletion_allele |