WormBase Tree Display for Variation: WBVar00089208
expand all nodes | collapse all nodes | view schema
WBVar00089208 | Evidence | Person_evidence | WBPerson554 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mu74 | ||||||
Other_name | T02C5.5l.1:c.3517_3582+9del | |||||||
T02C5.5h.1:c.3712_3777+9del | ||||||||
T02C5.5p.1:c.4078_4143+9del | ||||||||
T02C5.5j.1:c.3517_3582+9del | ||||||||
T02C5.5c.1:c.3244_3309+9del | ||||||||
T02C5.5n.1:c.3946_4011+9del | ||||||||
T02C5.5i.1:c.3712_3777+9del | ||||||||
T02C5.5f.1:c.3712_3777+9del | ||||||||
T02C5.5k.1:c.3517_3582+9del | ||||||||
T02C5.5q.1:c.3520_3585+9del | ||||||||
T02C5.5m.1:c.3517_3582+9del | ||||||||
T02C5.5b.1:c.3646_3711+9del | ||||||||
T02C5.5g.1:c.3712_3777+9del | ||||||||
T02C5.5a.1:c.3244_3309+9del | ||||||||
T02C5.5o.1:c.3922_3987+9del | ||||||||
HGVSg | CHROMOSOME_X:g.2718795_2718869del | |||||||
Sequence_details | SMap | S_parent | Sequence | T02C5 | ||||
Flanking_sequences | ttgttttatgaagaaattttgaggcttttc | tttcagatttcagaaagctgtacagcagta | ||||||
Mapping_target | T02C5 | |||||||
Type_of_mutation | Deletion | aataccgcattaacggccgtgtttacagtggagagtatattgaagattttggcattcggtgttagagtaagttaa | Person_evidence | WBPerson554 | ||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CF | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006742 | ||||||
Transcript (15) | ||||||||
Genetics | Interpolated_map_position | X | -13.8049 | |||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | resembles e55 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000005 | Person_evidence | WBPerson554 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Complete | Person_evidence | WBPerson554 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson554 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Null | Person_evidence | WBPerson554 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000023 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | resembles e55 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000164 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | resembles e55 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000556 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | resembles e55 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004583 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson554 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Complete | Person_evidence | WBPerson554 | |||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Person_evidence | WBPerson554 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Variation_effect | Null | Person_evidence | WBPerson554 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | resembles e55 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00006052 | |||||||
Remark | mu74 deletes the exon/intron boundary so it is likely that 3' protein synthesis would cease at the next stop codon within the intron. | Person_evidence | WBPerson554 | |||||
Method | Deletion_allele |