WormBase Tree Display for Variation: WBVar00089204
expand all nodes | collapse all nodes | view schema
WBVar00089204 | Evidence | Paper_evidence | WBPaper00003383 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mu39 | |||||||
Other_name | W08D2.1.1:c.497G>A | ||||||||
W08D2.1.2:c.497G>A | |||||||||
W08D2.1.3:c.497G>A | |||||||||
CE25152:p.Cys166Tyr | |||||||||
HGVSg | CHROMOSOME_IV:g.9814467C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | W08D2 | |||||
Flanking_sequences | aaggctgtaatactggaaatctaacagaat | tggatgtgacagtaaaccaggaatgcagag | |||||||
Mapping_target | W08D2 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004817 | ||||||||
Laboratory | CF | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001188 | |||||||
Transcript | W08D2.1.3 (12) | ||||||||
W08D2.1.1 (12) | |||||||||
W08D2.1.2 (12) | |||||||||
Interactor | WBInteraction000538541 | ||||||||
WBInteraction000538545 | |||||||||
WBInteraction000538550 | |||||||||
WBInteraction000538553 | |||||||||
Genetics | Interpolated_map_position | IV | 4.42291 | ||||||
Description | Phenotype (16) | ||||||||
Phenotype_not_observed | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark (2) | |||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit crumpled spicules; crumpled spicules is characteristic of other egl-20 mutants. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000298 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit incomplete migration of rays 1 and 2 into the tail; incomplete migration of these rays is characteristic of other egl-20 mutants. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000827 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit A/P reversal of the V5 lineage; this A/P reversal is characteristic of other egl-20 mutants. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001235 | Paper_evidence | WBPaper00004436 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | At all temperatures tested, egl-20(mu39) animals exhibited wild type V5 cell division polarity (Table 1) | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004890 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004876 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004250 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007446 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004246 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007463 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00004436 | |||||||||
WBPaper00025979 | |||||||||
WBPaper00005809 | |||||||||
WBPaper00002582 | |||||||||
WBPaper00057074 | |||||||||
Method | Substitution_allele |