WormBase Tree Display for Variation: WBVar00089199
expand all nodes | collapse all nodes | view schema
WBVar00089199 | Evidence | Paper_evidence | WBPaper00001767 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mu26 | |||||||
Other_name | C07H6.7.2:c.635G>A | ||||||||
CE03975:p.Trp212Ter | |||||||||
C07H6.7.1:c.635G>A | |||||||||
HGVSg | CHROMOSOME_III:g.7529776C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C07H6 | |||||
Flanking_sequences | atataaaacactctgtttcaggtcaaaattt | gtttcaaaatcgacgaatgaagcacaaaaaa | |||||||
Mapping_target | C07H6 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001767 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CF | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003024 | |||||||
Transcript | C07H6.7.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C07H6.7.2:c.635G>A | ||||||||
HGVSp | CE03975:p.Trp212Ter | ||||||||
cDNA_position | 740 | ||||||||
CDS_position | 635 | ||||||||
Protein_position | 212 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
C07H6.7.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C07H6.7.1:c.635G>A | ||||||||
HGVSp | CE03975:p.Trp212Ter | ||||||||
cDNA_position | 678 | ||||||||
CDS_position | 635 | ||||||||
Protein_position | 212 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | III | -0.681234 | ||||||
Description | Phenotype | WBPhenotype:0000227 | Paper_evidence | WBPaper00001861 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male turning ability similar to CP neuron ablation; many missed and some sloppy. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null (2) | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00001861 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Somata and processes of the ventral nerve cord are not serotonin-IR (immunoreactive), although the serotonin-IR neurons in the head and tail were normal. | Paper_evidence | WBPaper00001861 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005300 | PATO:0000460 | Paper_evidence | WBPaper00001861 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001861 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001861 | ||||||||
Method | Substitution_allele |