WormBase Tree Display for Variation: WBVar00089142
expand all nodes | collapse all nodes | view schema
WBVar00089142 | Evidence | Paper_evidence | WBPaper00024501 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mn391 | ||||||
Other_name | M02B7.3b.1:c.1315C>T | |||||||
CE31568:p.Gln439Ter | ||||||||
M02B7.3a.3:c.1231C>T | ||||||||
M02B7.3a.2:c.1231C>T | ||||||||
CE31567:p.Gln411Ter | ||||||||
M02B7.3a.1:c.1231C>T | ||||||||
HGVSg | CHROMOSOME_IV:g.3797443G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | M02B7 | ||||
Flanking_sequences | gaagaagcggcgaagaagatccaacagctc | aagatcagtttattggaggagaagaagcag | ||||||
Mapping_target | M02B7 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024501 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034363 | |||||||
Laboratory | SP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003884 | ||||||
Transcript | M02B7.3a.3 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | M02B7.3a.3:c.1231C>T | |||||||
HGVSp | CE31567:p.Gln411Ter | |||||||
cDNA_position | 1475 | |||||||
CDS_position | 1231 | |||||||
Protein_position | 411 | |||||||
Exon_number | 6/11 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
M02B7.3a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | M02B7.3a.1:c.1231C>T | |||||||
HGVSp | CE31567:p.Gln411Ter | |||||||
cDNA_position | 1329 | |||||||
CDS_position | 1231 | |||||||
Protein_position | 411 | |||||||
Exon_number | 7/12 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
M02B7.3a.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | M02B7.3a.2:c.1231C>T | |||||||
HGVSp | CE31567:p.Gln411Ter | |||||||
cDNA_position | 1920 | |||||||
CDS_position | 1231 | |||||||
Protein_position | 411 | |||||||
Exon_number | 7/12 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
M02B7.3b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | M02B7.3b.1:c.1315C>T | |||||||
HGVSp | CE31568:p.Gln439Ter | |||||||
cDNA_position | 1315 | |||||||
CDS_position | 1315 | |||||||
Protein_position | 439 | |||||||
Exon_number | 6/10 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | IV | -2.21384 | |||||
Description | Phenotype | WBPhenotype:0001441 | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed significantly reduced chemotaxis to ammonium acetate compared to wild-type animals. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00002790 | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | For the water soluble chemotaxis assay, radial gradients of NH4Ac were established by diffusion in the agar. | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001484 | Paper_evidence | WBPaper00031959 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed significantly reduced chemotaxis to ammonium acetate in both the soluble and odorant assays, compared to wild-type animals. | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031959 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00002790 | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were tested in both soluble and odorant chemotaxis assays. For the soluble assay, radial gradients of NH4Ac were established by diffusion in the agar. For the odorant assay, a droplet of NH4Ac (10 mL, 7.5 M) was suspended from the lid of the plate. | Paper_evidence | WBPaper00031959 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00002087 | ||||||
WBPaper00024501 | ||||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Defects in dye filling. | Paper_evidence | WBPaper00002087 | |||||
Curator_confirmed | WBPerson48 | |||||||
Based on defective dye filling | Paper_evidence | WBPaper00024501 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Recessive | Paper_evidence | WBPaper00002087 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Phenotype_not_observed | WBPhenotype:0000663 | Paper_evidence | WBPaper00024501 | |||||
Curator_confirmed | WBPerson48 | |||||||
Reference | WBPaper00024501 | |||||||
WBPaper00002087 | ||||||||
WBPaper00031959 | ||||||||
WBPaper00010097 | ||||||||
WBPaper00025332 | ||||||||
Method | Substitution_allele |