WormBase Tree Display for Variation: WBVar00089103
expand all nodes | collapse all nodes | view schema
| WBVar00089103 | Evidence | Person_evidence | WBPerson625 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | mn216 | |||||||
| Other_name | ZK1067.1c.1:c.1420G>A | ||||||||
| ZK1067.1d.1:c.1441G>A | |||||||||
| CE03840:p.Gly469Arg | |||||||||
| CE50411:p.Gly481Arg | |||||||||
| CE42891:p.Gly408Arg | |||||||||
| ZK1067.1b.1:c.1222G>A | |||||||||
| ZK1067.1a.1:c.1405G>A | |||||||||
| CE42910:p.Gly474Arg | |||||||||
| HGVSg | CHROMOSOME_II:g.9201268G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||||
| Flanking_sequences | caatgcgatgacttggaagaactgagcttaaactcattgaaacttataaaaact | gagctgtattaataatgaaaaatcatcgattgtgttatgtgtcgaaaattgattggtcatca | |||||||
| Mapping_target | ZK1067 | ||||||||
| Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson625 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | SP | ||||||||
| Person | WBPerson625 | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00002299 | |||||||
| Transcript | ZK1067.1d.1 (12) | ||||||||
| ZK1067.1b.1 (12) | |||||||||
| ZK1067.1c.1 (12) | |||||||||
| ZK1067.1a.1 (12) | |||||||||
| Isolation | Mutagen | EMS | |||||||
| Forward_genetics | balanced lethal | ||||||||
| Genetics | Interpolated_map_position | II | 1.09443 | ||||||
| Description | Phenotype | WBPhenotype:0000411 | Paper_evidence | WBPaper00000762 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00000762 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Only observed in a let-23 heteroallelic strain: mn216/n1045 | Paper_evidence | WBPaper00000762 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00000762 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | mn216/n1045 | Paper_evidence | WBPaper00000762 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00014296 | ||||||||
| WBPaper00000762 | |||||||||
| WBPaper00014627 | |||||||||
| WBPaper00013924 | |||||||||
| WBPaper00001917 | |||||||||
| Remark | isolated by RK Herman; sequenced by Sternberg lab. | ||||||||
| alt_det = G469R. gga to aga codon mut_det = g to a | |||||||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00002299 Missense 469 G to R | |||||||||
| Method | Substitution_allele |
