WormBase Tree Display for Variation: WBVar00088794
expand all nodes | collapse all nodes | view schema
WBVar00088794 | Evidence | Paper_evidence | WBPaper00005913 | ||||
---|---|---|---|---|---|---|---|
Accession_evidence | AJ505905 | ||||||
Name | Public_name | mc44 | |||||
Other_name (14) | |||||||
HGVSg | CHROMOSOME_I:g.11751862_11752863del | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK1151 | |||
Flanking_sequences | ctccgcttttggaatcagttgctggagaac | agatgctccaccgcacctggcggctaccgt | |||||
Mapping_target | ZK1151 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00026573 | ||||||
Laboratory | ML | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006876 | |||||
Transcript | ZK1151.1n.1 (11) | ||||||
ZK1151.1k.1 (11) | |||||||
ZK1151.1j.1 (11) | |||||||
ZK1151.1m.1 (11) | |||||||
ZK1151.1c.1 (11) | |||||||
ZK1151.1o.1 (11) | |||||||
ZK1151.1l.1 (11) | |||||||
Genetics | Interpolated_map_position | I | 9.6126 | ||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00040080 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Embryonic or early larval lethality. | Paper_evidence | WBPaper00040080 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000057 | Paper_evidence | WBPaper00040080 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Embryonic or early larval lethality. | Paper_evidence | WBPaper00040080 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040080 | ||||||
WBPaper00005913 | |||||||
WBPaper00061173 | |||||||
Remark | mc44 is a 1033 bp deletion | Paper_evidence | WBPaper00005913 | ||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Deletion_allele |