WormBase Tree Display for Variation: WBVar00088780
expand all nodes | collapse all nodes | view schema
WBVar00088780 | Evidence | Paper_evidence | WBPaper00002025 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mc4 | |||||||
Other_name | F18A1.2c.1:c.1226G>A | ||||||||
F18A1.2a.1:c.1124G>A | |||||||||
CE52355:p.Trp427Ter | |||||||||
CE27972:p.Trp375Ter | |||||||||
CE48778:p.Met344Ile | |||||||||
CE04402:p.Trp409Ter | |||||||||
F18A1.2b.1:c.1032G>A | |||||||||
F18A1.2d.1:c.1280G>A | |||||||||
HGVSg | CHROMOSOME_II:g.7683989G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F18A1 | |||||
Flanking_sequences | ttttcagtaccgacgagatgcgtgccgaat | gaatctccgccttcacgaatgcttcccaga | |||||||
Mapping_target | F18A1 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | ML | ||||||||
Author | Labouesse M | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003012 | |||||||
Transcript | F18A1.2d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F18A1.2d.1:c.1280G>A | ||||||||
HGVSp | CE52355:p.Trp427Ter | ||||||||
cDNA_position | 1280 | ||||||||
CDS_position | 1280 | ||||||||
Protein_position | 427 | ||||||||
Exon_number | 5/5 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
F18A1.2b.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
PolyPhen | 0 | unknown | |||||||
HGVSc | F18A1.2b.1:c.1032G>A | ||||||||
HGVSp | CE48778:p.Met344Ile | ||||||||
cDNA_position | 1104 | ||||||||
CDS_position | 1032 | ||||||||
Protein_position | 344 | ||||||||
Exon_number | 4/5 | ||||||||
Codon_change | atG/atA | ||||||||
Amino_acid_change | M/I | ||||||||
F18A1.2a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F18A1.2a.1:c.1124G>A | ||||||||
HGVSp | CE27972:p.Trp375Ter | ||||||||
cDNA_position | 1124 | ||||||||
CDS_position | 1124 | ||||||||
Protein_position | 375 | ||||||||
Exon_number | 4/5 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
F18A1.2c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F18A1.2c.1:c.1226G>A | ||||||||
HGVSp | CE04402:p.Trp409Ter | ||||||||
cDNA_position | 1226 | ||||||||
CDS_position | 1226 | ||||||||
Protein_position | 409 | ||||||||
Exon_number | 5/5 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000570606 | ||||||||
Genetics | Interpolated_map_position | II | 0.516853 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00002025 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00002025 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000877 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
Remark | The number of sheath cells still expressing LIN-26 decreases in strong lof mc4 embryos; the amphid sheath nucleus had an abnormal morphology in 10 out of 18 embryos tracked from comma stage to normal hatching time. | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0000951 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
Remark | The number of socket cells still expressing LIN-26 decreases in strong lof mc4 embryos | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008379 | PATO:0000460 | Paper_evidence | WBPaper00002551 | ||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0001028 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
Remark | The number of sheath cells still expressing LIN-26 decreases in strong lof mc4 embryos; the amphid sheath nucleus had an abnormal morphology in 10 out of 18 embryos tracked from comma stage to normal hatching time. | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006754 | PATO:0000460 | Paper_evidence | WBPaper00002551 | ||||
Curator_confirmed | WBPerson351 | ||||||||
Life_stage | WBls:0000015 | PATO:0000460 | Paper_evidence | WBPaper00002551 | |||||
Curator_confirmed | WBPerson351 | ||||||||
GO_term | GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00002551 | |||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0001407 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
Remark | The number of socket cells still expressing LIN-26 decreases in strong lof mc4 embryos | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008379 | PATO:0000460 | Paper_evidence | WBPaper00002551 | ||||
Curator_confirmed | WBPerson351 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00002551 | |||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0002569 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
Remark | the outline of hypodermal nuclei became more difficult to distinguish in the strong mutant mc1 or mc4, suggesting a cell death or degenereration process | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Paper_evidence | WBPaper00002551 | ||||
Curator_confirmed | WBPerson351 | ||||||||
GO_term | GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00002551 | |||||
Curator_confirmed | WBPerson351 | ||||||||
Reference | WBPaper00002025 | ||||||||
WBPaper00002551 | |||||||||
Method | Substitution_allele |