WormBase Tree Display for Variation: WBVar00088778
expand all nodes | collapse all nodes | view schema
WBVar00088778 | Evidence | Paper_evidence | WBPaper00002025 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mc1 | |||||||
Other_name | F18A1.2c.1:c.1049G>A | ||||||||
F18A1.2a.1:c.947G>A | |||||||||
F18A1.2d.1:c.1103G>A | |||||||||
F18A1.2b.1:c.947G>A | |||||||||
CE27972:p.Gly316Glu | |||||||||
CE48778:p.Gly316Glu | |||||||||
CE52355:p.Gly368Glu | |||||||||
CE04402:p.Gly350Glu | |||||||||
HGVSg | CHROMOSOME_II:g.7683466G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F18A1 | |||||
Flanking_sequences | gtggaaagccaacaacactcaactcaacag | atctcgttggaatcttctgcgccacgtcat | |||||||
Mapping_target | F18A1 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026565 | ||||||||
Laboratory | ML | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003012 | |||||||
Transcript | F18A1.2d.1 (12) | ||||||||
F18A1.2b.1 (12) | |||||||||
F18A1.2a.1 (12) | |||||||||
F18A1.2c.1 (12) | |||||||||
Genetics | Interpolated_map_position | II | 0.516415 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000877 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0000951 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008379 | PATO:0000460 | Paper_evidence | WBPaper00002551 | ||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0002569 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
Remark | the outline of hypodermal nuclei became more difficult to distinguish in the strong mutant mc1 or mc4, suggesting a cell death or degenereration process | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Paper_evidence | WBPaper00002551 | ||||
Curator_confirmed | WBPerson351 | ||||||||
GO_term | GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00002551 | |||||
Curator_confirmed | WBPerson351 | ||||||||
Reference (5) | |||||||||
Method | Substitution_allele |