WormBase Tree Display for Variation: WBVar00088574
expand all nodes | collapse all nodes | view schema
WBVar00088574 | Evidence | Paper_evidence | WBPaper00003977 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | m86 | |||||||
Other_name | CE02205:p.Arg88Ter | ||||||||
F33H1.1e.1:c.262C>T | |||||||||
CE43609:p.Arg111Ter | |||||||||
F33H1.1c.1:c.214C>T | |||||||||
F33H1.1a.1:c.688C>T | |||||||||
F33H1.1b.1:c.763C>T | |||||||||
CE17763:p.Arg230Ter | |||||||||
CE01567:p.Arg72Ter | |||||||||
F33H1.1d.1:c.331C>T | |||||||||
CE28019:p.Arg255Ter | |||||||||
HGVSg | CHROMOSOME_II:g.10160814G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F33H1 | |||||
Flanking_sequences | gcagactcgatcaacttgccgaacaatcaa | gagcttcccccgcaacggtatgaataaaac | |||||||
Mapping_target | F33H1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003977 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (34) | |||||||||
Laboratory | DR | ||||||||
JT | |||||||||
NFB | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000914 | |||||||
Transcript | F33H1.1c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F33H1.1c.1:c.214C>T | ||||||||
HGVSp | CE01567:p.Arg72Ter | ||||||||
cDNA_position | 380 | ||||||||
CDS_position | 214 | ||||||||
Protein_position | 72 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F33H1.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F33H1.1a.1:c.688C>T | ||||||||
HGVSp | CE17763:p.Arg230Ter | ||||||||
cDNA_position | 713 | ||||||||
CDS_position | 688 | ||||||||
Protein_position | 230 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F33H1.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F33H1.1b.1:c.763C>T | ||||||||
HGVSp | CE28019:p.Arg255Ter | ||||||||
cDNA_position | 787 | ||||||||
CDS_position | 763 | ||||||||
Protein_position | 255 | ||||||||
Exon_number | 8/14 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F33H1.1e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F33H1.1e.1:c.262C>T | ||||||||
HGVSp | CE02205:p.Arg88Ter | ||||||||
cDNA_position | 262 | ||||||||
CDS_position | 262 | ||||||||
Protein_position | 88 | ||||||||
Exon_number | 3/8 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F33H1.1d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F33H1.1d.1:c.331C>T | ||||||||
HGVSp | CE43609:p.Arg111Ter | ||||||||
cDNA_position | 405 | ||||||||
CDS_position | 331 | ||||||||
Protein_position | 111 | ||||||||
Exon_number | 5/11 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor (54) | |||||||||
Genetics | Interpolated_map_position | II | 2.13278 | ||||||
Mapping_data | In_2_point | 444 | |||||||
769 | |||||||||
3381 | |||||||||
In_multi_point (3) | |||||||||
In_pos_neg_data | 4206 | ||||||||
4207 | |||||||||
4208 | |||||||||
4209 | |||||||||
4210 | |||||||||
4211 | |||||||||
4537 | |||||||||
Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00000932 | |||||
WBPaper00002149 | |||||||||
WBPaper00039866 | |||||||||
WBPaper00004071 | |||||||||
WBPaper00037652 | |||||||||
WBPaper00003977 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson641 | |||||||||
Remark | Pers. comm. to authors from D. Riddle. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
daf-19 (m86) mutants display a highly penetrant dauer constitutive (Daf-c) phenotype at all temperatures. | Paper_evidence | WBPaper00039866 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Constitutive dauer formation at 25C, reversible by shift to 15C. Easy to score (ES3) in L3. | Paper_evidence | WBPaper00004071 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 1 | Paper_evidence | WBPaper00003977 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00000932 | |||||
WBPaper00002149 | |||||||||
WBPaper00004071 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Paper_evidence | WBPaper00004071 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000017 | Paper_evidence | WBPaper00032252 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Remark | Figure 5 | Paper_evidence | WBPaper00032252 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00050371 | |||||||
WBPaper00003977 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson641 | |||||||||
Remark | "...we measured the expression change of the eY1H targets of DAF-19 by qRT-PCR in threefold embryos of daf-19(m86);daf-12(sa204) animals compared to daf-12(sa204) animals (the daf-12 mutation suppresses the dauer-constitutive phenotype of daf-19 mutants) (Senti & Swoboda, 2008). We confirmed that all previously reported DAF-19 targets are down regulated in daf-19 mutant animals (Fig 5B)."; "Values were normalized to the expression in the daf-12(sa204) strain..."; "We also detected significant downregulation for nine genes that were missed in the previous study (Phirke et al, 2011). Interestingly, these include three genes (F11E6.3, fbxb-69, and Y22D7AL.16) that do not harbor DAF-19 motifs in their promoters." | Paper_evidence | WBPaper00050371 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 3, Figure 5; concerns the genes che-2, osm-1, osm-6, xbx-1, which are all directly regulated by DAF-19; tested only for the m86 allele | Paper_evidence | WBPaper00003977 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Phenotype_assay | Genotype | daf-19(m86); daf-12(sa204) | Paper_evidence | WBPaper00050371 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000249 | Paper_evidence | WBPaper00004071 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000255 | Paper_evidence | WBPaper00035071 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants lack all ciliated structures. This phenotype can be rescued by expression of daf-19c, the CSN-specific isoform of daf-19 through functional rescue in single sensory cilia (FRISSC), which can restore gene function in a cell-autonomous and cell-specific manner. | Paper_evidence | WBPaper00035071 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00037652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The daf-19(m86) null allele abolishes osm-9 expression in PKD and all core neurons. | Paper_evidence | WBPaper00037652 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000310 | Paper_evidence | WBPaper00035071 | |||||||
WBPaper00039866 | |||||||||
WBPaper00004071 | |||||||||
WBPaper00003977 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson641 | |||||||||
Remark | Mutants lack all ciliated structures. This phenotype can be rescued by expression of daf-19c, the CSN-specific isoform of daf-19 through functional rescue in single sensory cilia (FRISSC), which can restore gene function in a cell-autonomous and cell-specific manner. | Paper_evidence | WBPaper00035071 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Cilia but not ciliary rootlets missing from sensory neurons. | Paper_evidence | WBPaper00004071 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 2, Figure 1 | Paper_evidence | WBPaper00003977 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
WBPhenotype:0000421 | Paper_evidence | WBPaper00032252 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Remark | Figure 5 | Paper_evidence | WBPaper00032252 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of ray sensilla. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00032252 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Remark | down-regulation of synaptic vesicle proteins SNB-1, UNC-17, UNC-64 (Table 1) | Paper_evidence | WBPaper00032252 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency 0, no detected matings. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002149 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-5(e1490) | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00003977 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Remark | Table 2, Figure 1; concerns neuron PQR - dendrites may be too long (low penetrance) | Paper_evidence | WBPaper00003977 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004096 | PATO:0000460 | Paper_evidence | WBPaper00003977 | ||||
Curator_confirmed | WBPerson641 | ||||||||
GO_term | GO:0030425 | PATO:0000460 | Paper_evidence | WBPaper00003977 | |||||
Curator_confirmed | WBPerson641 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Does not respond to dilute gradient of NaCl. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001434 | Paper_evidence | WBPaper00004071 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | defective chemotaxis | Paper_evidence | WBPaper00004071 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00032252 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Remark | Figure 4 | Paper_evidence | WBPaper00032252 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Acute CO2 avoidance is reduced | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001818 | Paper_evidence | WBPaper00035071 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants exhibited altered calcium transients in response to NaCl down-steps compared to control animals. | Paper_evidence | WBPaper00035071 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00055368 | |||||||
Curator_confirmed | WBPerson466 | ||||||||
Remark | survive 10nM ivermectin | Paper_evidence | WBPaper00055368 | ||||||
Curator_confirmed | WBPerson466 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00055368 | |||||
Curator_confirmed | WBPerson466 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
WBPaper00037652 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Amphids and phasmids rarely if ever stain with FITC at permissive or non-permissive temperatures. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005391 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C, 25C | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adult lifespan was not increased. Animals were allowed to progress through development at 15 degrees C. then shifted to 25.5 degrees C. to determine lifespan. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25.5C | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00035062 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In daf-19(m86) mutants, HYLS-1 localization was unaffected | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00003977 | |||||||
Curator_confirmed | WBPerson641 | ||||||||
Remark | Table 2, Figure1; concerns the microvilli at the dendritic tips of the thermosensory AFD neurons | Paper_evidence | WBPaper00003977 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00003977 | ||||
Curator_confirmed | WBPerson641 | ||||||||
GO_term | GO:0005902 | PATO:0000460 | Paper_evidence | WBPaper00003977 | |||||
Curator_confirmed | WBPerson641 | ||||||||
GO:0030425 | PATO:0000460 | Paper_evidence | WBPaper00003977 | ||||||
Curator_confirmed | WBPerson641 | ||||||||
WBPhenotype:0001530 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CEP does not stain with FITC at permissive or non-permissive temperatures. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005107 | PATO:0000460 | Paper_evidence | WBPaper00000932 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C, 25C | Paper_evidence | WBPaper00000932 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001535 | Paper_evidence | WBPaper00002149 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No FITC staining of ADE or PDE. | Paper_evidence | WBPaper00002149 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (24) | |||||||||
Remark | |||||||||
Method | Substitution_allele |