WormBase Tree Display for Variation: WBVar00088538
expand all nodes | collapse all nodes | view schema
WBVar00088538 | Evidence | Paper_evidence | WBPaper00002935 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | R13H8 | |||||
Flanking_sequences | gcaattctcatcagacatcgtttccttcgga | tgagctttttcataattattttttggagat | |||||||
Mapping_target | R13H8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002935 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006156 | ||||||||
WBStrain00006219 | |||||||||
WBStrain00006226 | |||||||||
WBStrain00006227 | |||||||||
WBStrain00006362 | |||||||||
WBStrain00006373 | |||||||||
WBStrain00006401 | |||||||||
WBStrain00006402 | |||||||||
WBStrain00026674 | |||||||||
Laboratory | DR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000912 | |||||||
WBGene00305568 | |||||||||
Transcript | R13H8.6 | ||||||||
R13H8.1i.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1i.1:c.383+1G>A | ||||||||
Intron_number | 4/10 | ||||||||
R13H8.1d.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1d.1:c.293+1G>A | ||||||||
Intron_number | 3/11 | ||||||||
R13H8.1l.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1l.1:c.53+1G>A | ||||||||
Intron_number | 1/7 | ||||||||
R13H8.1k.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1k.1:c.293+1G>A | ||||||||
Intron_number | 3/9 | ||||||||
R13H8.1b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1b.1:c.362+1G>A | ||||||||
Intron_number | 2/10 | ||||||||
R13H8.1h.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1h.1:c.455+1G>A | ||||||||
Intron_number | 5/11 | ||||||||
R13H8.1f.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1f.1:c.383+1G>A | ||||||||
Intron_number | 4/12 | ||||||||
R13H8.1m.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1m.1:c.53+1G>A | ||||||||
Intron_number | 1/7 | ||||||||
R13H8.1c.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R13H8.1c.1:c.362+1G>A | ||||||||
Intron_number | 2/10 | ||||||||
Interactor (27) | |||||||||
Genetics | Interpolated_map_position | I | 5.08422 | ||||||
Mapping_data | In_2_point | 441 | |||||||
In_multi_point | 335 | ||||||||
Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000316 | |||||
WBPaper00000504 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Defective dauer formation. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000033 | Paper_evidence | WBPaper00051068 | |||||||
Curator_confirmed | WBPerson7188 | ||||||||
Remark | Figure 3. Worms do not respond to population density-dependent acceleration of development (Pdda) | Paper_evidence | WBPaper00051068 | ||||||
Curator_confirmed | WBPerson7188 | ||||||||
WBPhenotype:0000383 | Paper_evidence | WBPaper00032150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Worms had lower levels of synthesized fatty acids compared to N2. | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Synchronized L1s were plated on mixed isotope feeding plates composed of 12C- and 13C-enriched E. coli cultures, and collected after 44-48 hr of feeding (worms were harvested as mid-L4 larvae). All experiments were carried out at 20 deg C. | Paper_evidence | WBPaper00032150 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000731 | Paper_evidence | WBPaper00029085 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Weak increase in levels of apoptosis in daf-16 loss-of-function mutants treated with IR | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029085 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006796 | PATO:0000460 | Paper_evidence | WBPaper00029085 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Treated with 60 Gy IR | Paper_evidence | WBPaper00029085 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00002149 | |||||||
WBPaper00038458 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25.5C | Paper_evidence | WBPaper00002149 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001655 | Paper_evidence | WBPaper00026674 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00026674 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002256 | Paper_evidence | WBPaper00044686 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Increased sensitivity to selenium induced movement decline | Paper_evidence | WBPaper00044686 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00001915 | Paper_evidence | WBPaper00044686 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0000061 | Paper_evidence | WBPaper00005086 | ||||||
WBPaper00040160 | |||||||||
WBPaper00001837 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Lifespan was not extended by astragalan treatment. | Paper_evidence | WBPaper00040160 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Lifespans of animals were normal. | Paper_evidence | WBPaper00001837 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005124 | Paper_evidence | WBPaper00040160 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00005086 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000592 | Paper_evidence | WBPaper00004599 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | daf-16(m26) mutants did not exhibit a significant change in response to copper, compared to wild type | Paper_evidence | WBPaper00004599 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00004599 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000681 | Paper_evidence | WBPaper00037649 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are as sensitive as WT. | Paper_evidence | WBPaper00037649 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00028759 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | At 20 deg C, the germline was immortal, however a single daf-16 strain became sterile when tested at 25 deg C. The authors note that this single strain may have become homozygous for a sterile, lethal or mortal germline mutation that either arose spontaneously during propagation or was segregating in the un-outcrossed m26 mutant background used for this study. Both daf-16(mu86) and daf-16(mgDf50) did not display this phenotype. | Paper_evidence | WBPaper00028759 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Strains propagated for many generations and checked for sterility | Paper_evidence | WBPaper00028759 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001616 | Paper_evidence | WBPaper00024698 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Trimethadione significantly extended life-span of mutant animals (N=58)(1 ind.exp.), although to a less extent than observed for WT animals. | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Lifespan analysis was performed on animals exposed to 2 mg/ml of the drug from fertilization until death. Animals were cultured on NGM plates containing the drug and seeded with OP50. | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20C | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001617 | Paper_evidence | WBPaper00024698 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ethosuximide significantly extended life-span of mutant animals (N=119)(3 ind.exp.), as it does for WT animals. | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Lifespan analysis was performed on animals exposed to 2 mg/ml of the drug from fertilization until death. Animals were cultured on NGM plates containing the drug and seeded with OP50. | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20C | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00004599 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | daf-16(m26) mutants did not exhibit a significant change in response to cadmium, compared to wild type | Paper_evidence | WBPaper00004599 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00004599 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002087 | Paper_evidence | WBPaper00031326 | |||||||
Curator_confirmed | WBPerson2857 | ||||||||
Remark | growth in hydrogen sulfide further enhances thermotolerance | Paper_evidence | WBPaper00031326 | ||||||
Curator_confirmed | WBPerson2857 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (32) | |||||||||
Method | Substitution_allele |