WormBase Tree Display for Variation: WBVar00088537
expand all nodes | collapse all nodes | view schema
| WBVar00088537 | Evidence | Paper_evidence | WBPaper00004181 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | m25 | |||||||
| Other_name (17) | |||||||||
| HGVSg | CHROMOSOME_X:g.10664677G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F11A1 | |||||
| Flanking_sequences | tgatattatgaatattatggatgttaccat | aggcgtttcgtcaaagttgccaaaggtgtt | |||||||
| Mapping_target | F11A1 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004181 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00006155 | ||||||||
| Laboratory | DR | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000908 | |||||||
| Transcript | F11A1.3b.1 (12) | ||||||||
| F11A1.3e.2 (12) | |||||||||
| F11A1.3e.1 (12) | |||||||||
| F11A1.3c.1 (12) | |||||||||
| F11A1.3e.4 (12) | |||||||||
| F11A1.3f.1 (12) | |||||||||
| F11A1.3a.1 (12) | |||||||||
| F11A1.3g.1 (12) | |||||||||
| F11A1.3e.3 (12) | |||||||||
| F11A1.3d.1 (12) | |||||||||
| Interactor | WBInteraction000052263 | ||||||||
| WBInteraction000052364 | |||||||||
| WBInteraction000052424 | |||||||||
| WBInteraction000518693 | |||||||||
| WBInteraction000518697 | |||||||||
| WBInteraction000518698 | |||||||||
| WBInteraction000524439 | |||||||||
| Genetics | Interpolated_map_position | X | 2.3691 | ||||||
| Mapping_data | In_multi_point | 1771 | |||||||
| Description | Phenotype | WBPhenotype:0000013 | Paper_evidence | WBPaper00000316 | |||||
| WBPaper00000504 | |||||||||
| WBPaper00002149 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001171 | Paper_evidence | WBPaper00002149 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mean life span slightly shorter than N2 under same conditions. In control experiments, the life spans were nearly like that of wild type at 15. | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002149 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00002149 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were raised at 15C and placed at 25.5C as L4 larvae or young adults for the life span assay. | Paper_evidence | WBPaper00002149 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 25.5C | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001654 | Paper_evidence | WBPaper00026674 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 3 | Paper_evidence | WBPaper00026674 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000154 | Paper_evidence | WBPaper00002149 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 15C, 25C | Paper_evidence | WBPaper00002149 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001692 | Paper_evidence | WBPaper00002589 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals were induced by pheromone to display the L2 M37 epitope to the same extent as wildtype e.g. animals exhibit ILD. | Paper_evidence | WBPaper00002589 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002535 | Paper_evidence | WBPaper00000932 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | FITC uptake is normal. | Paper_evidence | WBPaper00000932 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00000504 | ||||||||
| WBPaper00000932 | |||||||||
| WBPaper00002589 | |||||||||
| WBPaper00002149 | |||||||||
| WBPaper00000316 | |||||||||
| WBPaper00016006 | |||||||||
| WBPaper00026674 | |||||||||
| Method | Substitution_allele |
