WormBase Tree Display for Variation: WBVar00088505
expand all nodes | collapse all nodes | view schema
| WBVar00088505 | Evidence | Paper_evidence | WBPaper00026842 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | lq20 | |||||
| Other_name | CE16833:p.Pro29Leu | ||||||
| C09G12.8b.1:c.86C>T | |||||||
| CE16832:p.Pro29Leu | |||||||
| C09G12.8a.1:c.86C>T | |||||||
| HGVSg | CHROMOSOME_IV:g.3509408G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | C09G12 | |||
| Flanking_sequences | tcctgatatcctacaccacaaacgcatttc | cggagaatatattccgacggtgagtcattt | |||||
| Mapping_target | C09G12 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026842 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00024142 | ||||||
| Laboratory | LE | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000424 | |||||
| Transcript | C09G12.8a.1 (12) | ||||||
| C09G12.8b.1 (12) | |||||||
| Genetics | Interpolated_map_position | IV | -3.3176 | ||||
| Reference | WBPaper00026842 | ||||||
| Remark | Updated the flanking sequences to produce the published CCC to CTC codon change, and the amino-acid change P29L as this was incorrectly annotated. | Person_evidence | WBPerson580 | ||||
| Curator_confirmed | WBPerson1983 | ||||||
| Method | Substitution_allele |
