WormBase Tree Display for Variation: WBVar00088454
expand all nodes | collapse all nodes | view schema
WBVar00088454 | Evidence | Paper_evidence | WBPaper00028384 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky616 | |||||||
Other_name | Y38F2AL.1.3:c.104C>T | ||||||||
Y38F2AL.1.1:c.104C>T | |||||||||
Y38F2AL.1.2:c.104C>T | |||||||||
CE42187:p.Ser35Phe | |||||||||
HGVSg | CHROMOSOME_IV:g.2324167C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y38F2AL | |||||
Flanking_sequences | ggctctcaatcgccgcaattctcacaccct | ctggcaaatcgtaaaccttcgcgagtatgg | |||||||
Mapping_target | Y38F2AL | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00028384 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005274 | ||||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00021415 | |||||||
Transcript | Y38F2AL.1.3 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | Y38F2AL.1.3:c.104C>T | ||||||||
HGVSp | CE42187:p.Ser35Phe | ||||||||
cDNA_position | 116 | ||||||||
CDS_position | 104 | ||||||||
Protein_position | 35 | ||||||||
Exon_number | 2/8 | ||||||||
Codon_change | tCc/tTc | ||||||||
Amino_acid_change | S/F | ||||||||
Y38F2AL.1.2 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | Y38F2AL.1.2:c.104C>T | ||||||||
HGVSp | CE42187:p.Ser35Phe | ||||||||
cDNA_position | 209 | ||||||||
CDS_position | 104 | ||||||||
Protein_position | 35 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | tCc/tTc | ||||||||
Amino_acid_change | S/F | ||||||||
Y38F2AL.1.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | Y38F2AL.1.1:c.104C>T | ||||||||
HGVSp | CE42187:p.Ser35Phe | ||||||||
cDNA_position | 110 | ||||||||
CDS_position | 104 | ||||||||
Protein_position | 35 | ||||||||
Exon_number | 2/8 | ||||||||
Codon_change | tCc/tTc | ||||||||
Amino_acid_change | S/F | ||||||||
Interactor | WBInteraction000052103 | ||||||||
Genetics | Interpolated_map_position | IV | -7.98569 | ||||||
Description | Phenotype | WBPhenotype:0001512 | Paper_evidence | WBPaper00029404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not express str-2::GFP in either AWC cell, e.g. both AWC neurons are AWC off (n=94). Overexpression of nsy-4 rescued AWCL more efficiently than AWCR | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005832 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005833 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0003827 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0003826 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | str-2::GFP | Paper_evidence | WBPaper00029404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000717 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | NSY-5::GFP expression was unaltered (data not shown). | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | NSY-5::GFP | Paper_evidence | WBPaper00029404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00029404 | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00021415 Missense 35 S to F | Paper_evidence | WBPaper00028384 | ||||||
Method | Substitution_allele |