WormBase Tree Display for Variation: WBVar00088435
expand all nodes | collapse all nodes | view schema
WBVar00088435 | Evidence | Paper_evidence | WBPaper00004523 | ||
---|---|---|---|---|---|
Name | Public_name | ky326 | |||
Other_name | F15A2.6a.1:c.2413_2493del | ||||
CE28218:p.Asp805_Thr831del | |||||
CE40646:p.Asp805_Thr831del | |||||
F15A2.6b.1:c.2413_2493del | |||||
HGVSg | CHROMOSOME_X:g.13489623_13489703del | ||||
Sequence_details | SMap | S_parent | Sequence | F15A2 | |
Flanking_sequences | gtagagtctttaaaaaatctttccttccag | ggtaattcaaaaaaaaatatttacacaaac | |||
Mapping_target | F15A2 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Laboratory | CX | ||||
Status | Live | ||||
Affects | Gene | WBGene00004719 | |||
Transcript | F15A2.6b.1 | VEP_consequence | inframe_deletion,splice_region_variant | ||
VEP_impact | MODERATE | ||||
HGVSc | F15A2.6b.1:c.2413_2493del | ||||
HGVSp | CE40646:p.Asp805_Thr831del | ||||
cDNA_position | 2529-2609 | ||||
CDS_position | 2413-2493 | ||||
Protein_position | 805-831 | ||||
Exon_number | 15/19 | ||||
Codon_change | GATAAAACTGAAACAACTTCTGCCACGTCATCTGACCCTTACGGTCCATCCCCGTCAATGCGATCTGTTGGAAGTGGAACA/- | ||||
Amino_acid_change | DKTETTSATSSDPYGPSPSMRSVGSGT/- | ||||
F15A2.6a.1 | VEP_consequence | inframe_deletion,splice_region_variant | |||
VEP_impact | MODERATE | ||||
HGVSc | F15A2.6a.1:c.2413_2493del | ||||
HGVSp | CE28218:p.Asp805_Thr831del | ||||
cDNA_position | 2523-2603 | ||||
CDS_position | 2413-2493 | ||||
Protein_position | 805-831 | ||||
Exon_number | 15/18 | ||||
Codon_change | GATAAAACTGAAACAACTTCTGCCACGTCATCTGACCCTTACGGTCCATCCCCGTCAATGCGATCTGTTGGAAGTGGAACA/- | ||||
Amino_acid_change | DKTETTSATSSDPYGPSPSMRSVGSGT/- | ||||
Genetics | Interpolated_map_position | X | 12.6465 | ||
Reference | WBPaper00004523 | ||||
Remark | ky326 is described as a deletion of amino acids 805-831, resulting in a subsequent frameshift. Breakpoints at the DNA level are not given; the left and right flanking sequences correspond to codons 805 and 831, respectively. | Paper_evidence | WBPaper00004523 | ||
Method | Deletion_allele |