WormBase Tree Display for Variation: WBVar00088400
expand all nodes | collapse all nodes | view schema
WBVar00088400 | Evidence | Paper_evidence | WBPaper00002892 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky51 | |||||||
Other_name | CE07832:p.Pro70Ser | ||||||||
C02C6.1a.1:c.208C>T | |||||||||
CE07833:p.Pro70Ser | |||||||||
C02C6.1b.1:c.208C>T | |||||||||
HGVSg | CHROMOSOME_X:g.15569193C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C02C6 | |||||
Flanking_sequences | ccacgtggatcaggaatcgtaacacgtcgt | cacttattttgcagcttattcaagatcgca | |||||||
Mapping_target | C02C6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005217 | ||||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | X | 22.8498 | ||||||
Description | Phenotype (19) | ||||||||
Phenotype_not_observed | WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PKD-2::GFP dendritic and ciliary localization was not obviously altered in dyn-1(ky51) mutants. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00062703 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Pre-axotomy imaging and analysis showed no visible difference <in EBP-2::GFP pattern> between wild-type and dyn-1(ky51) mutant animals before axotomy (Figure 1 A-C). | Paper_evidence | WBPaper00062703 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00062703 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were incubated for at least 2 hours at 25C before confocal imaging (top panels). | Paper_evidence | WBPaper00062703 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00062703 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001260 | Paper_evidence | WBPaper00003831 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Oocytes were morphologically wild-type. | Paper_evidence | WBPaper00003831 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00003831 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00003831 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | YP170::GFP | Paper_evidence | WBPaper00003831 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:0050709 | |||||||
Models_disease_in_annotation | WBDOannot00000798 | ||||||||
Reference (12) | |||||||||
Remark | missense, pro70 to ser within GTPase domain. email11 from wen chen | ||||||||
Method | Substitution_allele |