WormBase Tree Display for Variation: WBVar00088397

WBVar00088397 Evidence: Paper_evidence: WBPaper00002892
  Name: Public_name: ky48
    Other_name: ZC416.8b.1:c.295C>T
      CE17308:p.Pro99Ser
    HGVSg: CHROMOSOME_IV:g.3616425G>A
  Sequence_details: SMap: S_parent: Sequence: ZC416
    Flanking_sequences: gaaaaatataccccggatttgaattcacgg cgttggcatcctaactctcatatacatctc
    Mapping_target: ZC416
    Type_of_mutation: Substitution: g a
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CX
    Status: Live
  Affects: Gene: WBGene00000481
    Transcript: ZC416.8b.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: ZC416.8b.1:c.295C>T
        HGVSp: CE17308:p.Pro99Ser
        cDNA_position: 361
        CDS_position: 295
        Protein_position: 99
        Exon_number: 5/12
        Codon_change: Ccc/Tcc
        Amino_acid_change: P/S
  Genetics: Interpolated_map_position: IV -3.11749
  Description: Phenotype: WBPhenotype:0000643 Paper_evidence: WBPaper00002892
        Curator_confirmed: WBPerson712
        Remark: Animals were wild-type or nearly wild-type when maintained at 15C, but became severely uncoordinated when shifted to 25C. When shifted back to 15C, animals recover normal locomotion. Paper_evidence: WBPaper00002892
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 25 Paper_evidence: WBPaper00002892
              Curator_confirmed: WBPerson712
  Reference: WBPaper00002892
    WBPaper00061430
  Remark: WBPaper00061430: Protein change:P99S, Temperature sensitive: Yes. Flanking sequences in supplemental material refer to CDS located on minus strand.
  Method: Substitution_allele