WormBase Tree Display for Variation: WBVar00088391
expand all nodes | collapse all nodes | view schema
WBVar00088391 | Evidence | Paper_evidence | WBPaper00005620 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ky27 | ||||||
Other_name (16) | ||||||||
HGVSg | CHROMOSOME_IV:g.1875810C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F55A8 | ||||
Flanking_sequences | gaggaggtccgtacagccaatattattgca | aagctccaggagttgaagtacttactttgg | ||||||
Mapping_target | F55A8 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | CX | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001173 | ||||||
Transcript | F55A8.2g.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F55A8.2g.1:c.328C>T | |||||||
HGVSp | CE49110:p.Gln110Ter | |||||||
cDNA_position | 328 | |||||||
CDS_position | 328 | |||||||
Protein_position | 110 | |||||||
Exon_number | 3/5 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F55A8.2e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F55A8.2e.1:c.1105C>T | |||||||
HGVSp | CE37241:p.Gln369Ter | |||||||
cDNA_position | 1322 | |||||||
CDS_position | 1105 | |||||||
Protein_position | 369 | |||||||
Exon_number | 9/12 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F55A8.2d.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | F55A8.2d.1:c.492+2118C>T | |||||||
Intron_number | 3/3 | |||||||
F55A8.2f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F55A8.2f.1:c.286C>T | |||||||
HGVSp | CE37242:p.Gln96Ter | |||||||
cDNA_position | 414 | |||||||
CDS_position | 286 | |||||||
Protein_position | 96 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F55A8.2b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F55A8.2b.1:c.1087C>T | |||||||
HGVSp | CE19898:p.Gln363Ter | |||||||
cDNA_position | 1087 | |||||||
CDS_position | 1087 | |||||||
Protein_position | 363 | |||||||
Exon_number | 8/10 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F55A8.2c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F55A8.2c.1:c.1123C>T | |||||||
HGVSp | CE31541:p.Gln375Ter | |||||||
cDNA_position | 1123 | |||||||
CDS_position | 1123 | |||||||
Protein_position | 375 | |||||||
Exon_number | 8/11 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F55A8.2h.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F55A8.2h.1:c.1225C>T | |||||||
HGVSp | CE48610:p.Gln409Ter | |||||||
cDNA_position | 1225 | |||||||
CDS_position | 1225 | |||||||
Protein_position | 409 | |||||||
Exon_number | 8/11 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F55A8.2a.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F55A8.2a.2:c.1216C>T | |||||||
HGVSp | CE19897:p.Gln406Ter | |||||||
cDNA_position | 1216 | |||||||
CDS_position | 1216 | |||||||
Protein_position | 406 | |||||||
Exon_number | 8/12 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F55A8.2a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F55A8.2a.1:c.1216C>T | |||||||
HGVSp | CE19897:p.Gln406Ter | |||||||
cDNA_position | 1216 | |||||||
CDS_position | 1216 | |||||||
Protein_position | 406 | |||||||
Exon_number | 8/11 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | IV | -14.2734 | |||||
Description | Phenotype (17) | |||||||
Phenotype_not_observed | WBPhenotype:0000249 | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants were found to be wild type in their responses to osmotic shock (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000302 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants have normal responses to the odorant benzaldehyde | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00002087 | Paper_evidence | WBPaper00004310 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000398 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants were found to be wild type in their responses to gentle body touch (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000660 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants exhibit little if any clumpy behavior (iwhere animals tend to congregate in clumps) | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001086 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | All egl-4 mutants except n478 exhibit wild-type response to trimethylthiazole | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004538 | Paper_evidence | WBPaper00004310 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants were found to be wild type in their responses to nose touch (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001448 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants were found to be wild type in their responses to volatile repellents (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | egl-4 mutants dye-fill normally and no obvious defects in the morphology of the neurons were visible (data not shown). | Paper_evidence | WBPaper00004310 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00004310 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00004310 | |||||||
Method | Substitution_allele |