WormBase Tree Display for Variation: WBVar00088351
expand all nodes | collapse all nodes | view schema
WBVar00088351 | Evidence | Paper_evidence | WBPaper00004382 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | C37A2 | |||||
Flanking_sequences | tggaagttcttatcgtcaagtatattgggt | gagtcttgggccaatcacaagtattcaatg | |||||||
Mapping_target | C37A2 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004382 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000871 | |||||||
Transcript | C37A2.4a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37A2.4a.1:c.1070G>A | ||||||||
HGVSp | CE24832:p.Trp357Ter | ||||||||
cDNA_position | 1085 | ||||||||
CDS_position | 1070 | ||||||||
Protein_position | 357 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
C37A2.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37A2.4b.1:c.1061G>A | ||||||||
HGVSp | CE33761:p.Trp354Ter | ||||||||
cDNA_position | 1083 | ||||||||
CDS_position | 1061 | ||||||||
Protein_position | 354 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | I | 1.3176 | ||||||
Description | Phenotype (19) | ||||||||
Phenotype_not_observed | WBPhenotype:0000166 | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Seam cells in cye-1 mutants fuse at the correct time during the late L4 stage | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | jcIs1[jam-1::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000354 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Despite fewer division cycles, vulval cells in cye-1 mutants can execute differentiation programs and acquire their correct terminal fates | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs21 [lin-11::GFP], ayIs4 [egl-17::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants generate relatively normal appearing cuticular structures, termed alae | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007832 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | jcIs1[jam-1::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00004382 | ||||||||
Method | Substitution_allele |