WormBase Tree Display for Variation: WBVar00088351
expand all nodes | collapse all nodes | view schema
WBVar00088351 | Evidence | Paper_evidence | WBPaper00004382 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku256 | |||||||
Other_name | CE33761:p.Trp354Ter | ||||||||
CE24832:p.Trp357Ter | |||||||||
C37A2.4a.1:c.1070G>A | |||||||||
C37A2.4b.1:c.1061G>A | |||||||||
HGVSg | CHROMOSOME_I:g.6783274G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C37A2 | |||||
Flanking_sequences | tggaagttcttatcgtcaagtatattgggt | gagtcttgggccaatcacaagtattcaatg | |||||||
Mapping_target | C37A2 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004382 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000871 | |||||||
Transcript | C37A2.4a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37A2.4a.1:c.1070G>A | ||||||||
HGVSp | CE24832:p.Trp357Ter | ||||||||
cDNA_position | 1085 | ||||||||
CDS_position | 1070 | ||||||||
Protein_position | 357 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
C37A2.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C37A2.4b.1:c.1061G>A | ||||||||
HGVSp | CE33761:p.Trp354Ter | ||||||||
cDNA_position | 1083 | ||||||||
CDS_position | 1061 | ||||||||
Protein_position | 354 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | I | 1.3176 | ||||||
Description | Phenotype | WBPhenotype:0000218 | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | A low percentage of cye-1(ku256) and cye-1(ar95) animals (<10%) displayed additional inductions in P4.p and P8.p | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants undergo only one round of proliferative divisions before executing a terminal division pattern. cye-1 mutants produce approx. 12 vulval cells, unlike wild-type animals (22 cells) | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000289 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants often lack a detectable uterus or contain a uterus that is unusually small | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006760 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000290 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants do not manufacture sperm | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000291 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants do not manufacture oocytes | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants display a number of abnormalities in the male tail including crumpled spicules, missing rays and ray fusions | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000297 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants display a number of abnormalities in the male tail including crumpled spicules, missing rays and ray fusions | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000318 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | High levels of rnr::GFP expression were detected in 87% of dividing vulval cells in cye-1 mutants compared with 45% in wild-type animals, consistent with a G1 delay | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | VT765 [rnr::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000503 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | DNA content of cye-1 gut cells ranges from approx. 2N to 8N (avg=4.22.4) indicating that endoreduplication is severely compromised in cye-1 mutants | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005792 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI-staining | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000510 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants produce approx. 12 vulval cells, resulting in a small and often asymmetric L4 invagination | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants also display a mild to moderate uncoordinated phenotype (Unc) that is manifested by abnormal kinking and coiling | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The total number of cells in the germline of cye-1 animals is relatively small compared to wild type | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants confer a Pvl-sterile phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000690 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Migration of the gonad arms is often aberrant in cye-1 mutants resulting in gonads of abnormal shapes | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Following eversion, vulvae from cye- 1 mutants protrude abnormally | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000701 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Unlike wild-type, cye-1 mutants averaged only 14.01.7 (range=10-16) GFP-positive seam cell nuclei per side, indicating a partially penetrant lineage defect | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | jcIs1[jam-1::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000900 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Unusually large cells are present in the germline gonad of cye-1 mutants | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001262 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants generally appear to be missing one or more vulval rings, consistent with the observed lineage defect. The remaining rings appear somewhat more disorganized than those of wildtype animals | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | jcIs1[jam-1::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001509 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants display a number of abnormalities in the male tail including crumpled spicules, missing rays and ray fusions | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000166 | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Seam cells in cye-1 mutants fuse at the correct time during the late L4 stage | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | jcIs1[jam-1::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000354 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Despite fewer division cycles, vulval cells in cye-1 mutants can execute differentiation programs and acquire their correct terminal fates | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs21 [lin-11::GFP], ayIs4 [egl-17::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cye-1 mutants generate relatively normal appearing cuticular structures, termed alae | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007832 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | jcIs1[jam-1::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00004382 | ||||||||
Method | Substitution_allele |