WormBase Tree Display for Variation: WBVar00088347
expand all nodes | collapse all nodes | view schema
WBVar00088347 | Evidence | Paper_evidence | WBPaper00003386 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku241 | |||||||
Other_name (11) | |||||||||
HGVSg | CHROMOSOME_X:g.5672227G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | W01C8 | |||||
Flanking_sequences | caacaataaagtcatgtggcctatggttca | atgctccatgccggcaatttcgactcggag | |||||||
Mapping_target | W01C8 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001182 | |||||||
Transcript (10) | |||||||||
Genetics | Interpolated_map_position | X | -4.40704 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00003386 | |||||
WBPaper00006298 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 100% (n=94) of animals are unable to lay eggs. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
WBPaper00006298 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Average brood size 6111 s.d. (n=58). Brood size was assayed by counting all progeny that emerged from an Egl corpse. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000283 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 95% (n=61) of animals with normal vulval morphology exhibited an AC block, e.g. the AC nucleus had not migrated from the apex of the vulva. N2 exhibits 0% AC block (n-32). | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000690 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 6% (n=162) gonad arms followed and abnormal migration path as viewed under Nomarski optics, compared to N2 (3%(n=108)). | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 5% (n=61) of animals exhibit grossly abnormal vulva morphology as compared to N2 (3%(n=32)). | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 26% (n=76) of animals have a protruding vulva. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000746 | Paper_evidence | WBPaper00006298 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 17/24 pi cell daughters were observed dividing (2 animals scored). No pi cell daughters were observed to undergo divisions in N2 animals. | Paper_evidence | WBPaper00006298 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007813 | PATO:0000460 | Paper_evidence | WBPaper00006298 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000825 | Paper_evidence | WBPaper00006298 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | As assayed by extra cell divisions of pi daughter cells. | Paper_evidence | WBPaper00006298 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007813 | PATO:0000460 | Paper_evidence | WBPaper00006298 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00006298 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000688 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% (n=76) of animals produce no progeny. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00003386 | ||||||||
WBPaper00006298 | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001182 Acceptor | ||||||||
Method | Substitution_allele |