WormBase Tree Display for Variation: WBVar00088337
expand all nodes | collapse all nodes | view schema
WBVar00088337 | Evidence | Paper_evidence | WBPaper00003386 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku207 | |||||||
Other_name (17) | |||||||||
HGVSg | CHROMOSOME_X:g.5672859G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | W01C8 | |||||
Flanking_sequences | tcaccaaaccatatcaaaagaccaatgaac | cattcatggtatgggctcgtgacgagagac | |||||||
Mapping_target | W01C8 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003386 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001182 | |||||||
Transcript (11) | |||||||||
Genetics | Interpolated_map_position | X | -4.40667 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 96% (n=75) of animals are completely unable to lay eggs. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Average brood size 5413 s.d. (n=48). Brood size was assayed by counting all progeny that emerged from an Egl corpse. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000283 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 85% (n=82) of animals with normal vulval morphology exhibited an AC block, e.g. the AC nucleus had not migrated from the apex of the vulva. N2 exhibits 0% AC block (n-32). | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 1% (n=75) of animals produce no progeny. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000690 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 12% (n=129) gonad arms followed and abnormal migration path as viewed under Nomarski optics, compared to N2 (3%(n=108)). | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 13% (n=82) of animals exhibit grossly abnormal vulva morphology as compared to N2 (3%(n=32)). Only 1% of animals have normal L4 vulva morphology. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 44% (n=75) of animals have a protruding vulva. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001508 | Paper_evidence | WBPaper00003386 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 26 of 33 L4 and young adult animals displayed a distinct pattern of cdh::gfp fluorescence indicative of the lack of fusion between the AC and utse cells. WT worms (n=30) display a diffuse staining pattern as a result of normal AC-utse cell fusion. | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004522 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006789 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000036 | PATO:0000460 | Paper_evidence | WBPaper00003386 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001414 | Paper_evidence | WBPaper00003386 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00003386 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00003386 | ||||||||
WBPaper00019788 | |||||||||
WBPaper00026078 | |||||||||
Method | Substitution_allele |