WormBase Tree Display for Variation: WBVar00088323
expand all nodes | collapse all nodes | view schema
WBVar00088323 | Evidence | Paper_evidence | WBPaper00006388 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ku119 | |||||||
Other_name | F01G12.2a.2:c.-74+1G>A | ||||||||
F01G12.2b.1:c.460+1G>A | |||||||||
F01G12.2a.1:c.-291G>A | |||||||||
HGVSg | CHROMOSOME_X:g.16377770G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F01G12 | |||||
Flanking_sequences | ttgaagaggctcatgagcatcccatagctt | taggttacctttgaattaaatatcataaaa | |||||||
Mapping_target | F01G12 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026504 | ||||||||
Laboratory | MH | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006353 | |||||||
Transcript | F01G12.2a.2 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01G12.2a.2:c.-74+1G>A | ||||||||
Intron_number | 3/9 | ||||||||
F01G12.2b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F01G12.2b.1:c.460+1G>A | ||||||||
Intron_number | 4/8 | ||||||||
F01G12.2a.1 | VEP_consequence | 5_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F01G12.2a.1:c.-291G>A | ||||||||
cDNA_position | 473 | ||||||||
Exon_number | 3/9 | ||||||||
Interactor | WBInteraction000002330 | ||||||||
WBInteraction000002974 | |||||||||
WBInteraction000002975 | |||||||||
WBInteraction000524413 | |||||||||
WBInteraction000524414 | |||||||||
WBInteraction000524415 | |||||||||
WBInteraction000524617 | |||||||||
Genetics | Interpolated_map_position | X | 23.9133 | ||||||
Mapping_data | In_multi_point | 4958 | |||||||
Description | Phenotype | WBPhenotype:0000671 | Paper_evidence | WBPaper00006388 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | sur-7(ku119) mutant animals exhibited a statistically significant increased tolerance to copper at a concentration of 0.5 millimolar (data not shown) | Paper_evidence | WBPaper00006388 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00006388 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001747 | Paper_evidence | WBPaper00033166 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Unlike wild-type, sur-7 mutant animals displayed reduced maturation at low and high concentrations of dietary zinc | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00003477 | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Eggs were transferred to CeMM with 18-19 different concentrations of zinc, ranging from no added zinc to 2 mM zinc | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001749 | Paper_evidence | WBPaper00006388 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | sur-7(ku119) animals were more sensitive to increasing concentrations of zinc than wild type (Figure 2). The progeny of animals placed on metal-supplemented growth media showed increasing sensitivity to zinc concentrations at and above 0.25 millimolar as assayed by their rate of developmental maturation. These differences were found to be significant at and above 1.0 millimolar zinc (student's t-test: a 0.05). | Paper_evidence | WBPaper00006388 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00005064 | Paper_evidence | WBPaper00006388 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001849 | Paper_evidence | WBPaper00033166 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | sur-7 mutant animals displayed dramatic growth defects and relatively normal zinc content suggesting that the distribution of zinc is abnormal in mutant animals | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00005064 | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Determination of zinc content of C. elegans using inductively coupled plasma-mass spectrometry (ICP-MS) | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001175 | Paper_evidence | WBPaper00048917 | ||||||
Curator_confirmed | WBPerson721 | ||||||||
WBPhenotype:0001272 | Paper_evidence | WBPaper00006388 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | In an otherwise wild-type background, sur-7(ku119) exhibits no obvious vulva underinduction defects. | Paper_evidence | WBPaper00006388 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00006388 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00006388 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00006388 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002226 | Paper_evidence | WBPaper00006388 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003058 | Paper_evidence | WBPaper00006388 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00006388 | ||||||||
WBPaper00033166 | |||||||||
WBPaper00048917 | |||||||||
Remark | Suppresses an activated ras allele [050715 td3] | Paper_evidence | WBPaper00006388 | ||||||
Method | Substitution_allele |