WormBase Tree Display for Variation: WBVar00088292

WBVar00088292 Evidence: Paper_evidence: WBPaper00004963
  Name: Public_name: ks67
    Other_name: B0240.3a.1:c.2308G>A
      CE42996:p.Asp770Asn
      B0240.3b.1:c.1654G>A
      CE50867:p.Asp552Asn
    HGVSg: CHROMOSOME_V:g.11720885C>T
  Sequence_details: SMap: S_parent: Sequence: B0240
    Flanking_sequences: gtttatgaaaatgcaacgattctttattcg atattgttggatttacttctttgtgttcac
    Mapping_target: B0240
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00004963
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007511
    Laboratory: FK
    Status: Live
  Affects: Gene: WBGene00000907
    Transcript: B0240.3a.1 (12)
      B0240.3b.1 (12)
    Interactor: WBInteraction000500196
  Genetics: Interpolated_map_position: V 3.29055
  Description: Phenotype: WBPhenotype:0000012 Paper_evidence: WBPaper00038115
        Curator_confirmed: WBPerson712
        Remark: Population increases from less to 0% at 15 deg C. to ~30% dauer at 25 deg C. Paper_evidence: WBPaper00038115
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00038115
              Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 25 Paper_evidence: WBPaper00038115
              Curator_confirmed: WBPerson712
      WBPhenotype:0000725 Paper_evidence: WBPaper00059441
        Curator_confirmed: WBPerson28815
      WBPhenotype:0001184 Paper_evidence: WBPaper00059441
        Curator_confirmed: WBPerson28815
      WBPhenotype:0001236 Paper_evidence: WBPaper00038115
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit an increase in expression levels of Ex[Pdaf-28::GFP] in ASJ and ASI and Ex[Ptrx-1::GFP] in ASJ. Paper_evidence: WBPaper00038115
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000027 PATO:0000460 Paper_evidence: WBPaper00038115
                Curator_confirmed: WBPerson712
            WBls:0000035 PATO:0000460 Paper_evidence: WBPaper00038115
                Curator_confirmed: WBPerson712
      WBPhenotype:0002055 Paper_evidence: WBPaper00036207
        Curator_confirmed: WBPerson712
        Remark: There were no photocurrents in ASJ from mutants. | Supplementing daf-11 mutant worms with non-saturating levels of cGMP did not restore photosensitivity in ASJ. | GTPgammaS failed to stimulate CNG channels in ASJ of daf-11 mutant worms, whereas cGMP was still able to efficiently activate CNG channels in this mutant. Paper_evidence: WBPaper00036207
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000306 Paper_evidence: WBPaper00038115
        Curator_confirmed: WBPerson712
        Remark: Levels of trx-1 are increased in mutant dauers like that in wild type dauer larvae when compared to L2/L3 wild type animals. Likewise, levels of daf-28 are reduced like that in wild type dauer larvae when compared to L2/L3 wild type animals, as assayed by the average relative intensity of fluorescence of ofEx379[Ptrx-1::GFP; Pelt-2::mCherry] or ofEx345[Pdaf-28::GFP; Pelt-2::mCherry], respectively. Paper_evidence: WBPaper00038115
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000032 PATO:0000460 Paper_evidence: WBPaper00038115
                Curator_confirmed: WBPerson712
  Reference: WBPaper00038115
    WBPaper00004963
    WBPaper00036207
    WBPaper00059441
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000907 Missense
  Method: Substitution_allele