WormBase Tree Display for Variation: WBVar00088255
expand all nodes | collapse all nodes | view schema
| WBVar00088255 | Evidence | Paper_evidence | WBPaper00004746 | ||
|---|---|---|---|---|---|
| Name | Public_name | km508 | |||
| Sequence_details | SMap | S_parent | Sequence | C33D9 | |
| Flanking_sequences | tttgttgtattatcatatttttaggatata | gccttggctatgctgccacttccaggatgt | |||
| Mapping_target | C33D9 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00024043 | ||||
| Laboratory | KU | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00001366 | |||
| Transcript | C33D9.1d.1 | ||||
| C33D9.1c.1 | |||||
| C33D9.1b.1 | |||||
| Genetics | Interpolated_map_position | IV | 3.96277 | ||
| Reference | WBPaper00004746 | ||||
| Remark | Tc1 is inserted at Cys776 (YSSEEDICALAML). The Cys758 reported in paper was based on C33D9.1. The flanking sequences are 30 bp to the left and right of this Cys codon [030414 ck1] | ||||
| Method | Transposon_insertion |
