WormBase Tree Display for Variation: WBVar00088110
expand all nodes | collapse all nodes | view schema
| WBVar00088110 | Evidence | Paper_evidence | WBPaper00002986 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | js44 | |||||
| Other_name | CE18252:p.Ala66Gly | ||||||
| T10H9.4.1:c.197C>G | |||||||
| HGVSg | CHROMOSOME_V:g.6656142G>C | ||||||
| Sequence_details | SMap | S_parent | Sequence | T10H9 | |||
| Flanking_sequences | agggtggccgcagatttctcaaattgtgaa | caccttcctggagagcgtcagctcggtcgt | |||||
| Mapping_target | T10H9 | ||||||
| Type_of_mutation | Substitution | g | c | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00029048 | ||||||
| Laboratory | NM | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004897 | |||||
| Transcript | T10H9.4.1 (12) | ||||||
| Genetics | Interpolated_map_position | V | 0.132256 | ||||
| Reference | WBPaper00002986 | ||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
