WormBase Tree Display for Variation: WBVar00088108
expand all nodes | collapse all nodes | view schema
WBVar00088108 | Evidence | Paper_evidence | WBPaper00003101 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | js21 | ||||||
Other_name | F56A8.7b.1:c.722C>T | |||||||
CE16127:p.Ala241Val | ||||||||
F56A8.7a.2:c.722C>T | ||||||||
F56A8.7a.1:c.722C>T | ||||||||
CE28035:p.Ala241Val | ||||||||
HGVSg | CHROMOSOME_III:g.13280587C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F56A8 | ||||
Flanking_sequences | ttgatcgaattgagtacaatgtggagcacg | gaaagaatttgttgatcgagcagtagctga | ||||||
Mapping_target | F56A8 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003101 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00029044 | |||||||
Laboratory | NM | |||||||
Status | Live | |||||||
Affects (2) | ||||||||
Genetics | Interpolated_map_position | III | 21.1995 | |||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Measured by the fraction of animals moving after incubation on 0.5mM aldicarb agar pads. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dispersal index in the absence of anesthetic ~0.64 was significantly reduced compared to N2 ~0.90. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001482 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ~4.8 body bends/minute compared with N2, ~18.6 BBM. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001609 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | EC50 ~0.13 compared with N2 EC50 ~0.75 vol%. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004563 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001611 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | EC50 ~0.17 compared with N2 EC50 ~0.42 vol%. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001705 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000680 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Measured by the fraction of animals moving after incubation on 0.1mM aldicarb agar pads. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00004721 | |||||||
WBPaper00018539 | ||||||||
Method | Substitution_allele |