WormBase Tree Display for Variation: WBVar00088104
expand all nodes | collapse all nodes | view schema
WBVar00088104 | Evidence | Paper_evidence | WBPaper00046810 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | jj3 | |||||
Other_name | R13F6.9.1:c.954+2T>A | ||||||
HGVSg | CHROMOSOME_III:g.6861787A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | R13F6 | |||
Flanking_sequences | atgaaaataattttaaattttaaaaacctc | cttgaaaaaataaattaaactcaaaaacgc | |||||
Mapping_target | R13F6 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00026338 | ||||||
Laboratory | LW | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004857 | |||||
Transcript | R13F6.9.1 | VEP_consequence | splice_donor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | R13F6.9.1:c.954+2T>A | ||||||
Intron_number | 10/13 | ||||||
Genetics | Interpolated_map_position | III | -0.917651 | ||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |