WormBase Tree Display for Variation: WBVar00088012
expand all nodes | collapse all nodes | view schema
WBVar00088012 | Evidence | Paper_evidence | WBPaper00001032 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | it32 | |||||||
Other_name (29) | |||||||||
HGVSg | CHROMOSOME_V:g.14120146G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | H39E23 | |||||
Flanking_sequences | ggtgtcggaccacaaacctctccagctgtt | aagtaccaacagaagatgcaacttcatcat | |||||||
Mapping_target | H39E23 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | KK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003916 | |||||||
Transcript (17) | |||||||||
Interactor | WBInteraction000503736 | ||||||||
Genetics | Interpolated_map_position | V | 6.15304 | ||||||
Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Complete | 100 percent | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 16C, 20C, 25C | Paper_evidence | WBPaper00001032 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001637 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Almost no terminal stage par-1 embryos produce any intestinal cells | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001642 | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Embryos exhibit altered early cleavage patterns | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001032 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001032 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001032 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001794 | Paper_evidence | WBPaper00032091 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | LSM-1 granules formed in both somatic and germline blastomeres unlike wild-type | Paper_evidence | WBPaper00032091 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00032091 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | anti-GFP staining | Paper_evidence | WBPaper00032091 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | axIs1437 [pie-1p::LAP:LSM-1] | Paper_evidence | WBPaper00032091 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001826 | Paper_evidence | WBPaper00032091 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In par-1 mutant embryos, nos-2 RNA was degraded throughout the embryo. This is in contrast to wild-type embryos, where nos-2 is degraded in somatic blastomeres, and is maintained only in germline blastomeres | Paper_evidence | WBPaper00032091 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00032091 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | In situ hybridization of nos-2 mRNA | Paper_evidence | WBPaper00032091 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | axIs1437 [pie-1p::LAP:LSM-1] | Paper_evidence | WBPaper00032091 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed (2) | |||||||||
Reference | WBPaper00001032 | ||||||||
WBPaper00032091 | |||||||||
Method | Substitution_allele |