WormBase Tree Display for Variation: WBVar00087961
expand all nodes | collapse all nodes | view schema
| WBVar00087961 | Evidence | Paper_evidence | WBPaper00006309 | ||
|---|---|---|---|---|---|
| Name | Public_name | id12 | |||
| Other_name | R07E4.4.1:c.199+1G>A | ||||
| HGVSg | CHROMOSOME_X:g.5948097C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | R07E4 | |
| Flanking_sequences | tattcgtttacaactggattagtacttcag | ttttactttaaattataaaactaatacatt | |||
| Mapping_target | R07E4 | ||||
| Type_of_mutation | Substitution | g | a | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | AS | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00003254 | |||
| Transcript | R07E4.4.1 | VEP_consequence | splice_donor_variant | ||
| VEP_impact | HIGH | ||||
| HGVSc | R07E4.4.1:c.199+1G>A | ||||
| Intron_number | 3/10 | ||||
| Genetics | Interpolated_map_position | X | -4.02575 | ||
| Reference | WBPaper00006309 | ||||
| Remark | The first nucleotide in the second intron was changed from g to a | Paper_evidence | WBPaper00006309 | ||
| Method | Substitution_allele |
