WormBase Tree Display for Variation: WBVar00087918
expand all nodes | collapse all nodes | view schema
| WBVar00087918 | Evidence | Paper_evidence | WBPaper00031592 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | hp102 | |||||
| Other_name (32) | |||||||
| HGVSg | CHROMOSOME_IV:g.6168669C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C11D2 | |||
| Flanking_sequences | ctgtaatcactgaaacatttgctgaaattc | agtccagttcagtgaaatgtggcagaaaaa | |||||
| Mapping_target | C11D2 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031592 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | ZM | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006809 | |||||
| Transcript (16) | |||||||
| Genetics | Interpolated_map_position | IV | 3.08513 | ||||
| Description | Phenotype | WBPhenotype:0000004 | Paper_evidence | WBPaper00031592 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000565 | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Mutants showed semi-dominant, uncoordinated, and exaggerated body bends during either spontaneous or stimulated locomotion. | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000616 | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibited unusually large HSN synapses. | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000679 | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibited abnormal active zone marker distribution. | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001316 | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | No ePSC could be evoked. | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001319 | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Some animals displayed a normal frequency of mPSC while others had no mPSC at all. | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Disease_info | Models_disease | DOID:0081048 | |||||
| Models_disease_in_annotation | WBDOannot00001101 | ||||||
| Reference | WBPaper00031592 | ||||||
| Method | Substitution_allele |
