WormBase Tree Display for Variation: WBVar00087742
expand all nodes | collapse all nodes | view schema
WBVar00087742 | Evidence | Paper_evidence | WBPaper00027653 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | hc1 | |||||
Other_name | CE42470:p.Gly163Glu | ||||||
F43G9.6b.1:c.488G>A | |||||||
F43G9.6a.1:c.869G>A | |||||||
CE10364:p.Gly290Glu | |||||||
HGVSg | CHROMOSOME_I:g.8629706C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F43G9 | |||
Flanking_sequences | agcaaagattctatgtgatggttcagtgtg | agcacacaagaccgaaacaacaatggaatc | |||||
Mapping_target | F43G9 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027653 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (8) | |||||||
Laboratory | BA | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001414 | |||||
Transcript | F43G9.6a.1 (12) | ||||||
F43G9.6b.1 (12) | |||||||
Interactor | WBInteraction000501921 | ||||||
Genetics | Interpolated_map_position | I | 3.00681 | ||||
Mapping_data | In_2_point | 25 | |||||
2507 | |||||||
2580 | |||||||
3214 | |||||||
In_multi_point (21) | |||||||
In_pos_neg_data | 743 | ||||||
752 | |||||||
761 | |||||||
Description | Phenotype (13) | ||||||
Phenotype_not_observed | WBPhenotype:0000033 | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals grow and develop at the same rate as wild type, initiating egg laying at 45 hr post-hatching, as do N2 hermaphrodites. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000186 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Oocytes are produced and are capable of being fertilized. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000284 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Sperm were transferred during copulation. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000670 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | At the start of their egg-laying period, 45 hr post-hatching at 25 deg C, the spermathecae of these hermaphrodites contain over 170 sperm. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals grow and develop at the same rate as wild type, initiating egg laying at 45 hr post-hatching, as do N2 hermaphrodites. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000982 | Paper_evidence | WBPaper00000495 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Spermatids do not differ from those of wild type males. | Paper_evidence | WBPaper00000495 | ||||
Curator_confirmed | WBPerson712 | ||||||
Disease_info | Models_disease | DOID:11724 | |||||
Models_disease_in_annotation | WBDOannot00000059 | ||||||
Reference | WBPaper00040337 | ||||||
WBPaper00014587 | |||||||
WBPaper00001075 | |||||||
WBPaper00000495 | |||||||
WBPaper00015973 | |||||||
WBPaper00015989 | |||||||
WBPaper00015949 | |||||||
WBPaper00044487 | |||||||
Remark | The paper states that this g to a mutation leads to a G(290)Q frameshift, but the sequence at this location infact leads to a G(290)E mutation | Curator_confirmed | WBPerson2970 | ||||
Method | Substitution_allele |