WormBase Tree Display for Variation: WBVar00054147
expand all nodes | collapse all nodes | view schema
WBVar00054147 | Evidence | Paper_evidence | WBPaper00005871 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00004414 | |||||||||
Person_evidence | WBPerson1687 | ||||||||
Name | Public_name | cg119 | |||||||
HGVSg | CHROMOSOME_V:g.12909170_12912298del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F54F3 | |||||
Flanking_sequences | atcatcattgttgactgtcttccttggttt | ccccgaatgtctacaatggattccaactga | |||||||
Mapping_target | F54F3 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005030 | ||||||||
WBStrain00047763 | |||||||||
WBStrain00047765 | |||||||||
WBStrain00047766 | |||||||||
Laboratory | CH | ||||||||
Person | WBPerson1687 | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | V | 4.72664 | ||||||
Mapping_data | In_multi_point | 4535 | |||||||
Description | Phenotype | WBPhenotype:0000616 | Paper_evidence | WBPaper00042396 | |||||
Curator_confirmed | WBPerson1687 | ||||||||
Remark | GABAergic neuromuscular junctions (NMJs) are elongated, morphologically abnormal | Paper_evidence | WBPaper00042396 | ||||||
Curator_confirmed | WBPerson1687 | ||||||||
Recessive | Paper_evidence | WBPaper00042396 | |||||||
Curator_confirmed | WBPerson1687 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00042396 | ||||||
Curator_confirmed | WBPerson1687 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00042396 | ||||
Curator_confirmed | WBPerson1687 | ||||||||
GO_term | GO:0050808 | PATO:0000460 | Paper_evidence | WBPaper00042396 | |||||
Curator_confirmed | WBPerson1687 | ||||||||
GO:0045202 | PATO:0000460 | Paper_evidence | WBPaper00042396 | ||||||
Curator_confirmed | WBPerson1687 | ||||||||
WBPhenotype:0000709 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Arrested larvae of nid-1 mutants have sometimes bent pharynges | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | urEx131[LAM-1::GFP] | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00053867 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Axon guidance defects of ventral nerve cord axons. | Paper_evidence | WBPaper00053867 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001748 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Pharynges do not attach to the hypoderm | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | urEx131[LAM-1::GFP] | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001785 | Paper_evidence | WBPaper00046360 | |||||||
Curator_confirmed | WBPerson3142 | ||||||||
Reference (12) | |||||||||
Remark | cg119 deletion removes exons 1-7 of the nid-1 coding region plus 948 bp upstream of the ATG and is a molecular null for NID-1 | Paper_evidence | WBPaper00005871 | ||||||
Tc1 excision | Person_evidence | WBPerson1687 | |||||||
Method | Deletion_allele |