WormBase Tree Display for Variation: WBVar00053967
expand all nodes | collapse all nodes | view schema
WBVar00053967 | Evidence | Paper_evidence | WBPaper00024985 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ce81 | |||||||
Other_name | R06A10.2b.1:c.274C>T | ||||||||
R06A10.2a.1:c.553C>T | |||||||||
CE49189:p.Arg92Cys | |||||||||
CE47896:p.Arg185Cys | |||||||||
HGVSg | CHROMOSOME_I:g.1071691C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | R06A10 | |||||
Flanking_sequences | gatccatccgagcaggacatccttcggtgt | gtgtcatgacaaccggcattttcgagacca | |||||||
Mapping_target | R06A10 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024985 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023478 | ||||||||
Laboratory | KG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001745 | |||||||
Transcript | R06A10.2a.1 (12) | ||||||||
R06A10.2b.1 (12) | |||||||||
Interactor | WBInteraction000518053 | ||||||||
WBInteraction000518360 | |||||||||
WBInteraction000518361 | |||||||||
Genetics | Interpolated_map_position | I | -16.9675 | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00038528 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00038528 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00038528 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00038528 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000105 | Paper_evidence | WBPaper00027739 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Oocytes in mutant females exhibit increased meiotic maturation rates in the absence of sperm | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027739 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | fog-3(q443) | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000106 | Paper_evidence | WBPaper00027739 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant hermaphrodites exhibit an expanded pattern of MAPK activation in which MAPKYT staining extends to distal oocytes | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027739 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Antibody staining to the diphosphorylated activated form of MAPK (MAPK-YT) | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00038528 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000642 | Paper_evidence | WBPaper00038528 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00038528 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00045634 | |||||||
Curator_confirmed | WBPerson13849 | ||||||||
Remark | decreased total quiescence | Paper_evidence | WBPaper00045634 | ||||||
Curator_confirmed | WBPerson13849 | ||||||||
Reference | WBPaper00038528 | ||||||||
WBPaper00027739 | |||||||||
WBPaper00024985 | |||||||||
WBPaper00045634 | |||||||||
Method | Substitution_allele |