WormBase Tree Display for Variation: WBVar00051617
expand all nodes | collapse all nodes | view schema
WBVar00051617 | Evidence | Paper_evidence | WBPaper00026712 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | cc615 | ||||||
Other_name | C39E6.4.1:c.76C>T | |||||||
CE30891:p.Gln26Ter | ||||||||
HGVSg | CHROMOSOME_X:g.4761537G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C39E6 | ||||
Flanking_sequences | agctcgcaagaacgtctcgaaaaaatgtca | aacttccaaagattgaactgatggaggaag | ||||||
Mapping_target | C39E6 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026712 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026332 | |||||||
Laboratory | PD | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003377 | ||||||
Transcript | C39E6.4.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C39E6.4.1:c.76C>T | |||||||
HGVSp | CE30891:p.Gln26Ter | |||||||
cDNA_position | 104 | |||||||
CDS_position | 76 | |||||||
Protein_position | 26 | |||||||
Exon_number | 2/8 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000502169 | |||||||
WBInteraction000502723 | ||||||||
WBInteraction000561295 | ||||||||
Genetics | Interpolated_map_position | X | -6.69088 | |||||
Mapping_data | In_multi_point | 4493 | ||||||
Description | Phenotype | WBPhenotype:0000411 | Paper_evidence | WBPaper00041013 | ||||
Curator_confirmed | WBPerson43879 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00041013 | ||||
Curator_confirmed | WBPerson43879 | |||||||
WBPhenotype:0000858 | Paper_evidence | WBPaper00041013 | ||||||
Curator_confirmed | WBPerson43879 | |||||||
Remark | Figure 2. Incompletely penetrant and cold sensitive lethal excretory system defects | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00041013 | ||||
Curator_confirmed | WBPerson43879 | |||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00056862 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | We first examined the expression pattern of stably integrated reporters for sra-6p::gfp, osm-10p::gfp and ceh-23p::gfp in mls-2(cc615) loss-of-function mutant animals. In addition to being expressed in the native ASH neurons, for each transgene we confirmed ectopic marker expression unilaterally or bilaterally in the ectopic ASH-like cells of mls-2(cc615) mutant animals, which were identified by dye-filling (Figure 1). We note that there was no obvious directional bias as to which side of the bilateral ASH-like pair the unilateral ectopic expression arose (Figure 1B). | Paper_evidence | WBPaper00056862 | |||||
Curator_confirmed | WBPerson712 | |||||||
Image | WBPicture0000014902 | Paper_evidence | WBPaper00056862 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001789 | Paper_evidence | WBPaper00041013 | ||||||
Curator_confirmed | WBPerson43879 | |||||||
Remark | Figure 2. Incompletely penetrant and cold sensitive lethal excretory system defects | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00041013 | |||||
Curator_confirmed | WBPerson43879 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00041013 | ||||
Curator_confirmed | WBPerson43879 | |||||||
Reference | WBPaper00026050 | |||||||
WBPaper00019783 | ||||||||
WBPaper00010835 | ||||||||
WBPaper00056862 | ||||||||
WBPaper00041013 | ||||||||
Remark | In addition to the Q(26)stop mutation there is an E(55)D mutation with flanks agataataagattaaattcaatatttctga & ttgctggaagatgacagaaaaccgtaagtt | Paper_evidence | WBPaper00026712 | |||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003377 Missense 55 E to D | Paper_evidence | WBPaper00026712 | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003377 Ochre_UAA Q(26) to stop | Paper_evidence | WBPaper00026712 | ||||||
Person_evidence | WBPerson1659" | |||||||
WBPerson1659 | ||||||||
Method | Substitution_allele |