WormBase Tree Display for Variation: WBVar00000595
expand all nodes | collapse all nodes | view schema
WBVar00000595 | Evidence | Paper_evidence | WBPaper00004312 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | bx92 | |||||
Other_name | CE16058:p.Gln3165Ter | ||||||
F47A4.2.1:c.9493C>T | |||||||
HGVSg | CHROMOSOME_X:g.9811647G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F47A4 | |||
Flanking_sequences | caacaacctctgcaacagccccagcaaagt | agcaatttcaacaaccagcacagcaagcta | |||||
Mapping_target | F47A4 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004312 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00007179 | ||||||
Laboratory | EM | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001081 | |||||
Transcript | F47A4.2.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F47A4.2.1:c.9493C>T | ||||||
HGVSp | CE16058:p.Gln3165Ter | ||||||
cDNA_position | 9596 | ||||||
CDS_position | 9493 | ||||||
Protein_position | 3165 | ||||||
Exon_number | 18/21 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000001327 | ||||||
WBInteraction000001415 | |||||||
WBInteraction000009226 | |||||||
WBInteraction000524364 | |||||||
WBInteraction000524368 | |||||||
WBInteraction000524369 | |||||||
WBInteraction000524370 | |||||||
WBInteraction000524371 | |||||||
WBInteraction000556084 | |||||||
WBInteraction000556085 | |||||||
Genetics | Interpolated_map_position | X | 1.66212 | ||||
Description | Phenotype | WBPhenotype:0000199 | Paper_evidence | WBPaper00004853 | |||
Curator_confirmed | WBPerson2987 | ||||||
Remark | sop-1(bx92) suppressed the missing male tail ray phenotype of pal-1(e2091) mutant animals | Paper_evidence | WBPaper00004853 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00004312 | ||||||
WBPaper00004853 | |||||||
Method | Substitution_allele |