WormBase Tree Display for Variation: WBVar00000371
expand all nodes | collapse all nodes | view schema
WBVar00000371 | Evidence | Paper_evidence | WBPaper00002243 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | T19C3 | ||||
Flanking_sequences | aacggagttctaaatctcacccgagcactc | gagatgttcctggacggccgatgatctcta | ||||||
Mapping_target | T19C3 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002243 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005816 | |||||||
Laboratory | DH | |||||||
Status | Live | |||||||
Linked_to | WBVar00000372 | |||||||
WBVar00000373 | ||||||||
WBVar00000374 | ||||||||
WBVar00000375 | ||||||||
Affects | Gene | WBGene00001412 | ||||||
Transcript | T19C3.8.1 (12) | |||||||
Interactor | WBInteraction000501744 | |||||||
WBInteraction000502809 | ||||||||
WBInteraction000521254 | ||||||||
WBInteraction000534749 | ||||||||
WBInteraction000557073 | ||||||||
WBInteraction000557076 | ||||||||
WBInteraction000558238 | ||||||||
WBInteraction000576793 | ||||||||
Genetics | Interpolated_map_position | III | -26.4551 | |||||
Mapping_data | In_2_point | 1607 | ||||||
1608 | ||||||||
In_multi_point | 856 | |||||||
857 | ||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00035459 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | At 20C, fem-2(b245) mutants led to only modest embryonic lethality | Paper_evidence | WBPaper00035459 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000105 | Paper_evidence | WBPaper00028730 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | animals exhibit oocyte maturation defects; however, after being crossedwith wild-type (N2) males, fem-2 (b245ts) mutant females were able to produce progeny, | Paper_evidence | WBPaper00028730 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00028730 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000290 | Paper_evidence | WBPaper00028730 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | RT-PCR quantification of the sperm-specific marker msp-77 clearly showed that sperm were in fact absent | Paper_evidence | WBPaper00028730 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00028730 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001779 | Paper_evidence | WBPaper00035664 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Expression of miRNAs 35-41 is unaffected | Paper_evidence | WBPaper00035664 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035664 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (17) | ||||||||
Method | Substitution_allele |